ID: 1183661179

View in Genome Browser
Species Human (GRCh38)
Location 22:39222365-39222387
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661179_1183661187 11 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661179_1183661185 2 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661185 22:39222390-39222412 ATGGGATGGCACCCAGGAAATGG No data
1183661179_1183661186 3 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661179_1183661184 -4 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661184 22:39222384-39222406 TGCTGTATGGGATGGCACCCAGG No data
1183661179_1183661190 17 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661179 Original CRISPR AGCAGCGCAGCAGAGTCCGT GGG (reversed) Intergenic