ID: 1183661180

View in Genome Browser
Species Human (GRCh38)
Location 22:39222366-39222388
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661180_1183661185 1 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661185 22:39222390-39222412 ATGGGATGGCACCCAGGAAATGG No data
1183661180_1183661187 10 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661180_1183661186 2 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661180_1183661190 16 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661180_1183661184 -5 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661184 22:39222384-39222406 TGCTGTATGGGATGGCACCCAGG 0: 1
1: 0
2: 2
3: 14
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661180 Original CRISPR CAGCAGCGCAGCAGAGTCCG TGG (reversed) Intergenic