ID: 1183661186

View in Genome Browser
Species Human (GRCh38)
Location 22:39222391-39222413
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661180_1183661186 2 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661174_1183661186 19 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661178_1183661186 12 Left 1183661178 22:39222356-39222378 CCTGGAAGGCCCACGGACTCTGC No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661176_1183661186 14 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661172_1183661186 23 Left 1183661172 22:39222345-39222367 CCCACCGGGCCCCTGGAAGGCCC No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661179_1183661186 3 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661173_1183661186 22 Left 1183661173 22:39222346-39222368 CCACCGGGCCCCTGGAAGGCCCA No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data
1183661177_1183661186 13 Left 1183661177 22:39222355-39222377 CCCTGGAAGGCCCACGGACTCTG No data
Right 1183661186 22:39222391-39222413 TGGGATGGCACCCAGGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661186 Original CRISPR TGGGATGGCACCCAGGAAAT GGG Intergenic