ID: 1183661187

View in Genome Browser
Species Human (GRCh38)
Location 22:39222399-39222421
Sequence CACCCAGGAAATGGGCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661177_1183661187 21 Left 1183661177 22:39222355-39222377 CCCTGGAAGGCCCACGGACTCTG No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661178_1183661187 20 Left 1183661178 22:39222356-39222378 CCTGGAAGGCCCACGGACTCTGC No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661179_1183661187 11 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661180_1183661187 10 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661174_1183661187 27 Left 1183661174 22:39222349-39222371 CCGGGCCCCTGGAAGGCCCACGG No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661173_1183661187 30 Left 1183661173 22:39222346-39222368 CCACCGGGCCCCTGGAAGGCCCA No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data
1183661176_1183661187 22 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661187 22:39222399-39222421 CACCCAGGAAATGGGCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661187 Original CRISPR CACCCAGGAAATGGGCACCC AGG Intergenic