ID: 1183661190

View in Genome Browser
Species Human (GRCh38)
Location 22:39222405-39222427
Sequence GGAAATGGGCACCCAGGCCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661178_1183661190 26 Left 1183661178 22:39222356-39222378 CCTGGAAGGCCCACGGACTCTGC No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661176_1183661190 28 Left 1183661176 22:39222354-39222376 CCCCTGGAAGGCCCACGGACTCT No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661177_1183661190 27 Left 1183661177 22:39222355-39222377 CCCTGGAAGGCCCACGGACTCTG No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661179_1183661190 17 Left 1183661179 22:39222365-39222387 CCCACGGACTCTGCTGCGCTGCT No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data
1183661180_1183661190 16 Left 1183661180 22:39222366-39222388 CCACGGACTCTGCTGCGCTGCTG No data
Right 1183661190 22:39222405-39222427 GGAAATGGGCACCCAGGCCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661190 Original CRISPR GGAAATGGGCACCCAGGCCT CGG Intergenic
No off target data available for this crispr