ID: 1183661354

View in Genome Browser
Species Human (GRCh38)
Location 22:39223336-39223358
Sequence CTTCCTCTATGGAGACCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 3, 3: 13, 4: 195}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183661350_1183661354 -3 Left 1183661350 22:39223316-39223338 CCCACGATGCTGAGGATCCACTT 0: 1
1: 0
2: 0
3: 3
4: 74
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661344_1183661354 12 Left 1183661344 22:39223301-39223323 CCACATCCAGCCCACCCCACGAT 0: 1
1: 0
2: 1
3: 30
4: 332
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661348_1183661354 1 Left 1183661348 22:39223312-39223334 CCACCCCACGATGCTGAGGATCC 0: 1
1: 0
2: 0
3: 9
4: 86
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661340_1183661354 18 Left 1183661340 22:39223295-39223317 CCCTCCCCACATCCAGCCCACCC 0: 1
1: 1
2: 11
3: 178
4: 1318
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661349_1183661354 -2 Left 1183661349 22:39223315-39223337 CCCCACGATGCTGAGGATCCACT 0: 1
1: 0
2: 0
3: 3
4: 92
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661347_1183661354 2 Left 1183661347 22:39223311-39223333 CCCACCCCACGATGCTGAGGATC 0: 1
1: 0
2: 0
3: 15
4: 94
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661343_1183661354 13 Left 1183661343 22:39223300-39223322 CCCACATCCAGCCCACCCCACGA 0: 1
1: 0
2: 0
3: 23
4: 247
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661345_1183661354 6 Left 1183661345 22:39223307-39223329 CCAGCCCACCCCACGATGCTGAG 0: 1
1: 0
2: 0
3: 13
4: 212
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661342_1183661354 14 Left 1183661342 22:39223299-39223321 CCCCACATCCAGCCCACCCCACG 0: 1
1: 0
2: 2
3: 43
4: 439
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661351_1183661354 -4 Left 1183661351 22:39223317-39223339 CCACGATGCTGAGGATCCACTTC 0: 1
1: 0
2: 0
3: 7
4: 77
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195
1183661341_1183661354 17 Left 1183661341 22:39223296-39223318 CCTCCCCACATCCAGCCCACCCC 0: 1
1: 1
2: 16
3: 172
4: 1342
Right 1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG 0: 1
1: 0
2: 3
3: 13
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183661354 Original CRISPR CTTCCTCTATGGAGACCCTC AGG Intergenic
900374089 1:2345427-2345449 CGTCCTCCTTGGAGAGCCTCGGG + Intronic
900458567 1:2789444-2789466 CTACCTCGAAGGAGACCCGCAGG + Intronic
900711198 1:4115531-4115553 CCTCTTCTATGGAGAAGCTCAGG - Intergenic
903994726 1:27298680-27298702 CCTCATCTTTGGAGACCATCAGG + Intronic
904005517 1:27361203-27361225 CTTCCTCTATGCACTCCCCCCGG - Exonic
904390829 1:30184686-30184708 TTTCCTCCAGGGAGTCCCTCTGG + Intergenic
908627031 1:66056825-66056847 GTTCCTTTCTGGAGACCCTAAGG - Intronic
908808295 1:67953448-67953470 ATTCCTCTCTGAAGGCCCTCAGG + Intergenic
909075660 1:71047785-71047807 CTTCCTCTCTGGGAAACCTCTGG + Exonic
910030680 1:82718276-82718298 ATTCCTCTCTGGAGGCTCTCTGG - Intergenic
913685190 1:121225151-121225173 CTTCTTCCACGGAGACCATCTGG + Intronic
913962904 1:143353532-143353554 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914037036 1:144012756-144012778 CTTCTTCCACGGAGACCATCTGG + Intergenic
914057259 1:144179117-144179139 GTTCCCCAACGGAGACCCTCGGG + Intergenic
914121887 1:144787249-144787271 GTTCCCCAACGGAGACCCTCGGG - Intergenic
914152419 1:145055176-145055198 CTTCTTCCACGGAGACCATCTGG - Intronic
914381981 1:147124644-147124666 CCCCCTCAATGGTGACCCTCAGG - Intergenic
915142353 1:153775467-153775489 CTTCCTCTATCGGCACCGTCTGG - Exonic
915143387 1:153780311-153780333 CTTCGTCCTTGGAGAACCTCTGG + Intergenic
915351271 1:155227826-155227848 CTTCCTCTTCAGAGAGCCTCAGG + Intergenic
915354027 1:155244993-155245015 CTTCCTCTTTAGAGAGCCTCAGG + Intergenic
915399389 1:155611333-155611355 CTGCCCCTATGGAGACCCTCGGG - Intronic
915416503 1:155746913-155746935 CTGCCCCTATGGAGACCCTCAGG - Intergenic
917635011 1:176927116-176927138 CATCCTCTAAGGTGACGCTCAGG - Intronic
917856943 1:179108667-179108689 CTTCCTCTCAGAACACCCTCTGG - Exonic
918870474 1:189967103-189967125 CTTACTCTATGGTGAAACTCTGG - Intergenic
920472509 1:206243709-206243731 CTTCTTCCATGGAGACCATCTGG + Intronic
1064203321 10:13302216-13302238 CTTCCACTGGGGAGTCCCTCCGG + Intronic
1064385989 10:14892062-14892084 CTTACACGATGGAGACACTCAGG - Intronic
1065434180 10:25690376-25690398 CTTCCTTTCTGGAGACTCTAGGG + Intergenic
1066125192 10:32334860-32334882 CTCCCACTATGGAGACATTCTGG - Intronic
1067200919 10:44171584-44171606 CTCCCTCTTTGGAGCCTCTCGGG - Intergenic
1067891960 10:50144942-50144964 CTGCCTCTGAGGAGCCCCTCAGG + Intergenic
1068559949 10:58503171-58503193 GTTGCTCTATGGAGAGACTCAGG + Intergenic
1069914548 10:71779425-71779447 CATCATGGATGGAGACCCTCTGG + Intronic
1070757263 10:79001115-79001137 CTTCCTCTCTGGAGCACCTCTGG + Intergenic
1073593653 10:104779535-104779557 CTTCCTCCGTGGAGTCCCCCTGG - Intronic
1075638547 10:124047954-124047976 CTGCCTCTATGGAGACAGTGAGG - Intronic
1075784411 10:125039178-125039200 CTTACTCTCTGGAGACCCTCTGG + Intronic
1080839005 11:35967110-35967132 CTTCCATCATGGTGACCCTCGGG - Intronic
1081049198 11:38316140-38316162 CTTCCTGTAAGGAGAGACTCAGG + Intergenic
1081695617 11:45107123-45107145 CTTGCTCTATGGAGGCCCCTGGG - Intronic
1083178835 11:60971480-60971502 CTTCTTCTTAGAAGACCCTCGGG + Intergenic
1084404538 11:68963621-68963643 CTTCCTCTGTGGAGACCTCTTGG + Intergenic
1085047296 11:73360970-73360992 CTTCCCCTAAAGAGACCCTGAGG + Intronic
1092405864 12:8221863-8221885 CGTCCTCTATGAGGACCTTCAGG - Exonic
1096177843 12:49534861-49534883 CTTCCTCTCTGGAGGTCCCCAGG - Intergenic
1097939284 12:65286183-65286205 CTTGCTTTATGGATACTCTCAGG + Intronic
1098334661 12:69390818-69390840 CTTCCTCTTTGAAGACTTTCTGG + Intergenic
1102570853 12:113826106-113826128 CTTCCTCCACGGAGCCACTCAGG + Intronic
1103267253 12:119641061-119641083 CCCCCTATATGGAGACCCCCTGG - Exonic
1103961693 12:124612885-124612907 CTTCCGCTATGGAAACCATTTGG + Intergenic
1104740307 12:131167097-131167119 GTTCCTTTTTGGAGACCCTAGGG - Intergenic
1106670638 13:31900970-31900992 ATTCCTTTCTGGAGACTCTCGGG + Intergenic
1107816996 13:44253393-44253415 CTTCTTCTATGAAGACATTCTGG + Intergenic
1111754221 13:92372089-92372111 GTTCCTCTCTGGAGAACCTAGGG - Intronic
1113426834 13:110215134-110215156 CTTCCTCTTTAGAGACCATTAGG + Intronic
1118470552 14:66070875-66070897 CTTCCTCTACTGGGACCCTGAGG - Intergenic
1123930726 15:25170532-25170554 CTTCCTCCATGGTCACCATCTGG - Intergenic
1125322029 15:38499227-38499249 CCTACTCTAGGGAGACCCTCCGG + Intronic
1126273796 15:46851688-46851710 TTTCCTATATGGAGACTTTCTGG - Intergenic
1128506601 15:68277552-68277574 CTCCCTGGCTGGAGACCCTCAGG + Intergenic
1128603239 15:69015482-69015504 CTTCATCTCTCGGGACCCTCGGG - Intronic
1129141025 15:73598054-73598076 CTTCCTGAATGCAGACCCTCAGG + Intronic
1130576901 15:85101144-85101166 CTTCCTAAATGGAGATCCTTGGG - Intronic
1131632563 15:94194746-94194768 TTTCCTCTATAGGGACCATCTGG + Intergenic
1132865396 16:2090561-2090583 CTTCCTGTGTGGACTCCCTCTGG - Exonic
1135762251 16:25146786-25146808 CTTCCTCAATCGAGTCCCTGAGG - Intronic
1135965813 16:27034185-27034207 TGTCCACTATGGAGCCCCTCAGG + Intergenic
1138011858 16:53388746-53388768 ATTCCTCTTTGGAAACCCTTTGG - Intergenic
1141834732 16:86531375-86531397 CTCCCTCTGTGGACACACTCCGG - Exonic
1141875533 16:86821652-86821674 CTTCCACTAATGAGACTCTCTGG - Intergenic
1143747411 17:9004181-9004203 CCTCCTCTTTGGCGAACCTCGGG - Intergenic
1144389559 17:14780622-14780644 CTTTCTTTCCGGAGACCCTCTGG + Intergenic
1144485435 17:15660483-15660505 CTTCCTCCATGCAGACAATCAGG - Intronic
1145991694 17:29082957-29082979 CATCCACTAAGGAGACCTTCAGG - Intronic
1147782229 17:42951805-42951827 CTGCGTCTGTGGAGACCCTGGGG - Exonic
1148796222 17:50198195-50198217 CTCCCTCTATAGGGTCCCTCTGG - Exonic
1148871086 17:50659131-50659153 CCTCCTTTCTGGAGACCCTGGGG + Intronic
1149019531 17:51947154-51947176 CTTGCTCTTTAGAGGCCCTCAGG + Intronic
1149590554 17:57826741-57826763 TTTCCTCTATGAAGACCCGTGGG - Intergenic
1150310172 17:64121854-64121876 TTTCCTTGATGGAGACTCTCAGG + Intronic
1151172366 17:72257858-72257880 CTTCCTCAATGCAGGACCTCTGG - Intergenic
1151203520 17:72487857-72487879 CCTCCTGCATGGAGAACCTCTGG + Intergenic
1155977323 18:32145012-32145034 CAGCATGTATGGAGACCCTCTGG - Intronic
1158477952 18:57797163-57797185 AATCCTCTTTGGAAACCCTCAGG - Intronic
1159084899 18:63777804-63777826 CTTCCTCTATGAAGACAGTAAGG + Intronic
1161609886 19:5236696-5236718 CTTCAACTAGAGAGACCCTCCGG + Intronic
1161963755 19:7536361-7536383 CTTCCTTGATGGAGACCCCCTGG + Intronic
1202696742 1_KI270712v1_random:131790-131812 GTTCCCCAACGGAGACCCTCGGG + Intergenic
926120423 2:10238648-10238670 CCTCCTCCTTGCAGACCCTCTGG + Intergenic
927842525 2:26454736-26454758 CTTCCTCCAAGCAGAACCTCTGG + Exonic
928114327 2:28536137-28536159 CTTCCCCTGTGGAGACCTTTGGG + Intronic
928217293 2:29372249-29372271 CCTCCTGTATGGAGAGGCTCTGG + Intronic
928897521 2:36282222-36282244 CTTCCACAAGGGAGACTCTCTGG + Intergenic
933536861 2:83586104-83586126 TTTCCTCTATGGAGAACCAATGG - Intergenic
934277895 2:91588804-91588826 GTTCCCCAACGGAGACCCTCGGG + Intergenic
935595489 2:104874159-104874181 CTTCCTCCCAGGAGACCCGCAGG - Intergenic
936042043 2:109157476-109157498 CATACTCTCTGGACACCCTCTGG + Intronic
936350450 2:111708330-111708352 CTTCCTCTCAGGACACCCTAAGG + Intergenic
940667497 2:156626433-156626455 CTTCATCCATAAAGACCCTCTGG + Intergenic
941082665 2:161079857-161079879 TTTCCTCTTTGTAGACCCTTTGG + Intergenic
941651443 2:168096729-168096751 CTTCCTGTATGGAGAGCTTAGGG - Intronic
942108576 2:172657908-172657930 CTTCTTCTGGTGAGACCCTCAGG + Intergenic
944369674 2:198967240-198967262 TTTCCTCTTGGGAGACCCCCAGG + Intergenic
1169191602 20:3661794-3661816 CCTCCACCATGGAGACCCTTTGG + Intronic
1170793450 20:19526346-19526368 CTACCTCAATGGAGACACTGAGG - Intronic
1172098497 20:32472390-32472412 CTTCTGCAATGGAGACCCTCGGG + Intronic
1173690384 20:44956335-44956357 CCTCCTCTTCTGAGACCCTCAGG + Intronic
1174528915 20:51195568-51195590 CTGCCTCTGGGGAGAGCCTCAGG + Intergenic
1179121191 21:38547461-38547483 CTGCCTCTAAGGAGTCTCTCTGG + Intronic
1180091349 21:45535168-45535190 CCTCCTCCAGGGAGACCCCCCGG - Intronic
1181695598 22:24591378-24591400 TGTCCTCTAAAGAGACCCTCTGG - Intronic
1183661354 22:39223336-39223358 CTTCCTCTATGGAGACCCTCAGG + Intergenic
954246984 3:49339883-49339905 CTTCCTCTATGCAGAACCAGGGG - Intronic
955102304 3:55862264-55862286 CTTCATCTATGCAGAGTCTCTGG + Intronic
956040405 3:65139338-65139360 CTATTTCTATGGAAACCCTCTGG - Intergenic
956738769 3:72258893-72258915 CTTGCTCTATGGGGGCCCTTGGG + Intergenic
957848127 3:85766087-85766109 CTTCCTCTATTCAGACTATCAGG - Intronic
961573538 3:127817172-127817194 CTGCATTTATGGAGACCTTCTGG - Intronic
961837023 3:129670655-129670677 CTTCCTCTAAAGAGTCCTTCAGG + Exonic
962889477 3:139658418-139658440 CATCCCCTATCAAGACCCTCTGG + Intronic
968705618 4:2076082-2076104 CCTCCTTCATGGAGCCCCTCAGG + Intronic
969032849 4:4227531-4227553 GTTCCCCAACGGAGACCCTCGGG - Intergenic
969760266 4:9176104-9176126 CGTCCTCTATGAGGACCTTCAGG + Exonic
970486167 4:16526765-16526787 ATTCCTCTCTGGAGGCTCTCAGG - Intronic
972404728 4:38734854-38734876 CTTGCTCTCTGGAGCTCCTCAGG - Intergenic
975471160 4:74770070-74770092 CCTCCTCTGTGGAGACCCTGAGG - Exonic
978810157 4:112840567-112840589 CTTCCTCTTTGGACACCCCAGGG - Intronic
981219177 4:142211985-142212007 CTTGCTCAATGGTGAGCCTCAGG - Intronic
985606068 5:858645-858667 CTTTTTCCATGGGGACCCTCTGG + Intronic
986366494 5:7037881-7037903 ATTCCTTTATGGAGGCTCTCAGG + Intergenic
990312879 5:54556327-54556349 ATTCCTCTGTGGAGACTCTGCGG + Intergenic
992738757 5:79751439-79751461 CCTCCTCTTTGAAGCCCCTCTGG + Intronic
998529124 5:142868851-142868873 GGTCCTCTCTGGAGACTCTCAGG + Intronic
1003088130 6:3077848-3077870 CTTCCTCTATGATGACGCCCAGG - Exonic
1006073803 6:31516310-31516332 CCTCCTCTATGGAGATGCTGGGG + Intergenic
1006905163 6:37528409-37528431 CTTCCTCTTTGTGGAGCCTCGGG - Intergenic
1007429398 6:41767947-41767969 CTTGCTCTAGGGAGACCCCAGGG + Intergenic
1007593796 6:43039159-43039181 CTGCCTCTATGGCAAGCCTCAGG + Intronic
1008298496 6:49805976-49805998 CTTTCTCGGTGGAGTCCCTCAGG + Intergenic
1009381349 6:63034592-63034614 CTGCCTCTCTGGAGGCCCTGGGG + Intergenic
1010831637 6:80537962-80537984 CTTCCTCTATTGAGTACCTTTGG + Intergenic
1011753923 6:90479993-90480015 CTTTATCTATGGAGACCCTTTGG + Intergenic
1012431190 6:99165137-99165159 CCTCCTCTATGGATGACCTCTGG - Intergenic
1014975426 6:127875503-127875525 GTTCCACTGTGGAGTCCCTCTGG - Intronic
1017006400 6:150030622-150030644 TTTGCTCTATGGAGGCCATCAGG + Intergenic
1017766917 6:157614484-157614506 CCTTCTCTATGGAGAGCCTTGGG - Intronic
1018289077 6:162272092-162272114 CGCCCCCTATGGAGCCCCTCTGG - Intronic
1019073598 6:169369345-169369367 CTTCCTTTAGGGAGAGACTCGGG - Intergenic
1019577187 7:1743256-1743278 CGTCCTGCCTGGAGACCCTCAGG + Intronic
1020066312 7:5190659-5190681 CGCCCTCCAGGGAGACCCTCGGG + Intronic
1021331042 7:19339663-19339685 CTTCCTTTTTGGAGACCCACCGG + Intergenic
1022116283 7:27263847-27263869 CTTCCTCAAGGAAGACCCTGAGG - Intergenic
1023243677 7:38178159-38178181 GCTCCTCTATGGAGGCACTCAGG + Intergenic
1023836029 7:44067666-44067688 CTTCCTGGATGGAGGCCCTGAGG - Intronic
1024688930 7:51778727-51778749 CTTCCTACATTGATACCCTCAGG - Intergenic
1032497115 7:132370885-132370907 CATCCTCACTGGGGACCCTCAGG - Intronic
1033524038 7:142192523-142192545 CTTCTTCTATGAAGACTTTCTGG - Intronic
1034400805 7:150860406-150860428 CTTCCTCTATTCTGACCCTGAGG + Intronic
1034852527 7:154508339-154508361 GTTCCTCCATGGAGTCCTTCAGG + Intronic
1036263889 8:7259851-7259873 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036265185 8:7267473-7267495 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036266486 8:7275095-7275117 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036267792 8:7282717-7282739 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036269095 8:7290339-7290361 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036270389 8:7297961-7297983 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036297496 8:7549094-7549116 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036298800 8:7556741-7556763 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036300105 8:7564391-7564413 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036301409 8:7572036-7572058 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036302706 8:7579685-7579707 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036315929 8:7718390-7718412 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036317236 8:7726038-7726060 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036318544 8:7733686-7733708 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036319853 8:7741333-7741355 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036321160 8:7748981-7749003 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036322469 8:7756629-7756651 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036323777 8:7764277-7764299 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036325079 8:7771925-7771947 CGTCCTCTATGAGGACCTTCAGG + Intergenic
1036350965 8:8012383-8012405 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036352263 8:8020029-8020051 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036353562 8:8027677-8027699 CGTCCTCTATGAGGACCTTCAGG - Intergenic
1036812866 8:11879731-11879753 GATCCTCTCTGAAGACCCTCAGG - Intergenic
1036846249 8:12172802-12172824 CGTCCTCTATGAAGACCTTCAGG - Intergenic
1036867615 8:12415121-12415143 CGTCCTCTATGAAGACCTTCAGG - Intergenic
1038349041 8:26760003-26760025 CTTCCTCCCTGGGGACTCTCAGG - Intronic
1044458301 8:92414750-92414772 CTTGCTTTCTGGAGACCATCAGG + Intergenic
1046123318 8:109872245-109872267 CTCCCTCTATGGATACTCTTTGG + Intergenic
1047136955 8:122090217-122090239 CTTCCTTTATAGAGACTCTAGGG + Intergenic
1047316504 8:123739524-123739546 CTTCCTTTCTGGAGGGCCTCAGG + Intergenic
1050511235 9:6397924-6397946 CTTCTTCGATGGAGACAGTCAGG + Intergenic
1053243291 9:36514626-36514648 CCTCCTCTATGAAGCCCCACTGG + Intergenic
1053398703 9:37799440-37799462 CTACTTCTCTGGAGACCCCCTGG - Intronic
1054159378 9:61663324-61663346 CTTCCTCGGTGGAGAGTCTCAGG - Intergenic
1054479150 9:65594329-65594351 CTTCCTCGGTGGAGAGTCTCAGG - Intergenic
1055861692 9:80757966-80757988 CTTCCTCTAGGAAGACCCACAGG + Intergenic
1057845354 9:98518511-98518533 CTTCCTCCATGAAGTCCTTCTGG + Intronic
1058798489 9:108521330-108521352 CTTCCTCTTTGGACAACTTCAGG + Intergenic
1061001377 9:127904781-127904803 CTTCCTCGTTCCAGACCCTCTGG - Intronic
1061315830 9:129795278-129795300 CATCCCCTTTGGGGACCCTCTGG - Intergenic
1061621084 9:131811801-131811823 CTCTCTCTATGGACACCCTGGGG + Intergenic
1062047502 9:134431302-134431324 CTCCCTCCATGGAGACGCTGGGG - Intronic
1185535348 X:857070-857092 CTTCCACTTTGGAGACCCCTCGG - Intergenic
1185781773 X:2854133-2854155 CTTCCTGGATGCAGACACTCTGG + Exonic
1187098768 X:16171090-16171112 CTTCATCTATGGGGAGCCCCAGG + Exonic
1189877718 X:45454181-45454203 CTTCCTCTGTTGACACCCACAGG + Intergenic
1189901890 X:45714971-45714993 CTTCCTCTGAGGAAGCCCTCCGG + Intergenic
1191144024 X:57146804-57146826 CTTCATCTATTGAGACAATCAGG + Intergenic
1198718269 X:139586105-139586127 CTTGCTCTATTCAGACCTTCTGG - Intronic
1198963066 X:142203174-142203196 CTTCGTCTATGGGGAGCCTAGGG - Exonic
1201694267 Y:16807493-16807515 CTTATTCTATGGTGGCCCTCAGG - Intergenic