ID: 1183664289

View in Genome Browser
Species Human (GRCh38)
Location 22:39238440-39238462
Sequence GTGGTATTATTACCAAATCC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 2, 3: 2, 4: 105}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183664289 Original CRISPR GTGGTATTATTACCAAATCC GGG (reversed) Intronic
904983314 1:34524612-34524634 GTGGTAGCATTACCAAAACAGGG - Intergenic
905730343 1:40294908-40294930 GTGGTTTTAGTACCAAATGATGG + Intergenic
905942696 1:41876589-41876611 TTGTTATTATTACTAAACCCAGG + Intronic
911749783 1:101482789-101482811 GTGATACTATAACCAAATGCAGG - Intergenic
924442564 1:244098499-244098521 GTGGTATGATAACCATATTCAGG + Intergenic
1063928754 10:11007969-11007991 GTTGGATTATTACCAGCTCCCGG + Intronic
1068963769 10:62891554-62891576 GTGGCATTACTACCCAACCCAGG + Intronic
1073510400 10:104039231-104039253 GTGGTATTATTACAAAAAGGAGG - Intronic
1076174700 10:128359157-128359179 GTGGTCTTATTCACAAAGCCTGG - Intergenic
1076355032 10:129846383-129846405 GTGGTAATATTATCAACTGCGGG + Intronic
1078878821 11:15427171-15427193 GTGGATTTATTTTCAAATCCTGG - Intergenic
1083048712 11:59758034-59758056 GTGGTGTTCTTTCTAAATCCTGG + Intronic
1085078056 11:73609681-73609703 GTAGTATCATTACGAATTCCTGG + Intergenic
1086273114 11:85092268-85092290 TTGGGATTATGACCAAAACCTGG - Intronic
1088770263 11:113028238-113028260 GTTGTATAATGACCAAATCAGGG - Intronic
1088998541 11:115027962-115027984 GTGCTATTTTTACCAAATTTTGG - Intergenic
1092779180 12:11969677-11969699 TTTGTATTATTACCATAGCCTGG - Intergenic
1095496214 12:42787102-42787124 GTGGTAGCATTATCAAATCTTGG + Intergenic
1098889375 12:75993235-75993257 GTGGTATTTTTACCATCTCTTGG - Intergenic
1101093548 12:101312879-101312901 GTGGTATTAATAAAAAATTCCGG + Intronic
1101975230 12:109352138-109352160 GTGGTATTATGAACAGAGCCAGG - Intronic
1104565264 12:129875484-129875506 GTGGTATTCTCACCAAGTCATGG + Intronic
1107708714 13:43132044-43132066 GTGGTATTTTATCCAAATCCTGG - Intergenic
1110404335 13:75133111-75133133 GTGGTACTTTTCCCAAATGCAGG + Intergenic
1110662491 13:78073451-78073473 GTGGTACTATTTTCAAATACAGG - Intergenic
1116478777 14:45372326-45372348 GTGTTTTTATCACCAAATCTCGG - Intergenic
1120772425 14:88395193-88395215 GTGGTATAGTTATCAAAACCAGG + Intronic
1124558795 15:30752077-30752099 GTGTTATTACTACCACATTCAGG + Intronic
1124672463 15:31653668-31653690 GTGTTATTACTACCACATTCAGG - Intronic
1130121117 15:81048397-81048419 GCTGTTCTATTACCAAATCCAGG - Intronic
1137540982 16:49361469-49361491 GTGGGATTATTACCTAATCCAGG + Intergenic
1138549969 16:57742080-57742102 GTGGTACTATTAAGAACTCCAGG + Intronic
1140897037 16:79333751-79333773 GTGGTGATATCACCAGATCCAGG - Intergenic
1140897045 16:79333812-79333834 GTGATGATATTACCAGATCCAGG - Intergenic
1140897055 16:79333873-79333895 GTGGTGGTATCACCAGATCCAGG - Intergenic
1140897063 16:79333934-79333956 GTGGTTATATCACCAGATCCAGG - Intergenic
1146577003 17:34003190-34003212 GTGGTCTTGATATCAAATCCTGG + Intronic
1154072803 18:11168479-11168501 GTTGTATGATGACCAAATCTGGG + Intergenic
1156089867 18:33454440-33454462 GTGGTTATTTTCCCAAATCCAGG - Intergenic
1156162993 18:34382740-34382762 GTGGTATTACTACTAAATCCAGG + Intergenic
1158332257 18:56375566-56375588 TTAGTATTATTACAAAAGCCAGG - Intergenic
1158675627 18:59515434-59515456 ATGGTATCATTTCCAAATCTGGG + Intronic
1159422813 18:68245199-68245221 ATGGTATTCTTCTCAAATCCAGG - Intergenic
1159945662 18:74442714-74442736 GTGGTGATAGTTCCAAATCCTGG - Intronic
1164293094 19:23885051-23885073 AGGGTATTCTTACGAAATCCAGG + Intergenic
1166838937 19:45684406-45684428 ATGGTACTATTTCCAAACCCGGG - Intergenic
926023821 2:9521166-9521188 GTGGTGTTAGCACCATATCCAGG + Intronic
928586676 2:32766234-32766256 GTTGTATTATGATCAAATCAGGG + Intronic
928601132 2:32904505-32904527 TTAATATTATTACCTAATCCTGG - Intergenic
930055258 2:47247064-47247086 ATGGTTTTATAACCAAATTCTGG - Intergenic
933322102 2:80789901-80789923 TTGGTATTGGTACCAAATGCTGG + Intergenic
937533621 2:122858907-122858929 GTGGTACTATTTCCAAATGTTGG - Intergenic
939276737 2:140008096-140008118 GTGGTATTATTGAGAAATACTGG - Intergenic
942133838 2:172906335-172906357 GTGTTATTCTTCCCCAATCCTGG + Intronic
942317407 2:174708512-174708534 GTGATATTGTTTCAAAATCCAGG - Intergenic
943916321 2:193638078-193638100 ATGGAATGATTACCAAAACCAGG + Intergenic
945909648 2:215634412-215634434 GTGATTTTATTACAAAATTCTGG + Intergenic
948583860 2:239006195-239006217 GTGGTATAATAATCAAATCAGGG + Intergenic
1175050253 20:56148890-56148912 GTGGTTTTATTCCCACATCAGGG - Intergenic
1175704501 20:61166249-61166271 ATAGTATTATAACCAAATTCAGG + Intergenic
1177940700 21:27408080-27408102 GTGATATTATTAACCAGTCCTGG + Intergenic
1181555490 22:23669273-23669295 TTGGTATTATTAGTAAAGCCAGG - Intergenic
1182229838 22:28829240-28829262 CTGGTATTTTTACCAATCCCAGG + Intergenic
1183664289 22:39238440-39238462 GTGGTATTATTACCAAATCCGGG - Intronic
950664231 3:14485505-14485527 GTGGTATACCTTCCAAATCCTGG + Exonic
951486062 3:23211463-23211485 GTGGTATGATCTCCAACTCCTGG + Intronic
954074070 3:48163962-48163984 TTGATATTATTACCAATTTCAGG - Intronic
955574374 3:60343556-60343578 GTGGTATTAGTAGCATATCTGGG - Intronic
958081995 3:88758431-88758453 TAGGTATTATTATGAAATCCTGG - Intergenic
958846466 3:99270944-99270966 CAGGTATTATTACACAATCCAGG + Intergenic
959103123 3:102036344-102036366 TTGGAATTATGACCAAATCAAGG - Intergenic
960120504 3:113944098-113944120 GTGCTACTATAACAAAATCCTGG + Intronic
964889066 3:161516530-161516552 GTGATATTGTTTCAAAATCCAGG - Intergenic
965437395 3:168669315-168669337 GTGGTCTAATTACCATAGCCTGG - Intergenic
967081958 3:186058040-186058062 GGGGTATTATTACCAAACAGTGG + Intronic
969140040 4:5061744-5061766 GTGGTGTTCTTACCAAAGCCTGG + Intronic
976749492 4:88439718-88439740 GTTGTATTGTGACCAAAACCTGG - Intronic
980427188 4:132641127-132641149 GATGTATAATTATCAAATCCAGG - Intergenic
982441931 4:155446229-155446251 GTGTTTTTATTACCACAACCTGG + Intergenic
983046711 4:162995952-162995974 TGGGCATTATTCCCAAATCCTGG - Intergenic
983095125 4:163552408-163552430 GTGGTATCTTTACCCAAACCTGG - Intronic
983576606 4:169268298-169268320 GTGGAATTCTTAACAAATCATGG - Intronic
990388359 5:55291456-55291478 GTGGTATCATTGCCAAGTACAGG - Intronic
994394984 5:99220012-99220034 GTGATATTGTTTCAAAATCCAGG - Intergenic
994597308 5:101855981-101856003 GTGTTACTATTCCCATATCCAGG - Intergenic
1003969423 6:11283904-11283926 GTGATATGATTTCCAAACCCAGG - Intronic
1004026093 6:11820106-11820128 ATGGTATTAGAACAAAATCCTGG + Intergenic
1005152254 6:22765627-22765649 GTGGCATTACTGCCACATCCAGG + Intergenic
1008279191 6:49575569-49575591 GTGTTTTTCTTACAAAATCCTGG + Intergenic
1010418695 6:75646101-75646123 ATAGTCTTATTTCCAAATCCAGG - Intronic
1011521584 6:88212669-88212691 GGGGTATTATTTTCAAATTCCGG - Intergenic
1020643260 7:10781498-10781520 GAAACATTATTACCAAATCCTGG - Intergenic
1024864536 7:53889661-53889683 GTGATATAATTATCAAAGCCAGG - Intergenic
1028397601 7:90389224-90389246 GTGGTAATGTTACCATATGCTGG + Exonic
1028743256 7:94300411-94300433 GTGGCAGTATGTCCAAATCCTGG + Intergenic
1029927607 7:104334110-104334132 TTGCTATTATTACTATATCCTGG + Intronic
1038218090 8:25581453-25581475 GTTGTATTTTCACCAAATACGGG + Intergenic
1038373489 8:27014943-27014965 GTGGTTTTGTTACAAAAGCCTGG + Intergenic
1039413413 8:37374489-37374511 GTGCTATTATTACAAAGTACTGG - Intergenic
1042872174 8:73409256-73409278 GTGGTATTAATTTCACATCCAGG - Intergenic
1043462125 8:80471001-80471023 TTGATATTATTAACAAATACCGG + Intergenic
1044016516 8:87053313-87053335 GTGGCCTTATTACCAACTGCAGG - Intronic
1048108276 8:131437168-131437190 GTGGTGTAATTATCAAATCATGG - Intergenic
1187485213 X:19696666-19696688 GTGGCTCTATTACAAAATCCAGG - Intronic
1189089954 X:38071357-38071379 TTGAACTTATTACCAAATCCAGG + Intronic
1189214969 X:39315001-39315023 GTCATATTCTTACCAATTCCTGG - Intergenic
1196614646 X:117754087-117754109 GTGGTGTTATTCTCAAATGCTGG - Intergenic
1196666776 X:118325528-118325550 TTAATATTTTTACCAAATCCAGG + Intergenic
1197219528 X:123898082-123898104 GTGGTACTATTAACCAATACAGG - Intronic
1198566553 X:137911089-137911111 TTGCTATAATAACCAAATCCAGG + Intergenic