ID: 1183665465

View in Genome Browser
Species Human (GRCh38)
Location 22:39243753-39243775
Sequence CTGGGTGACCTCTTCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665465_1183665477 7 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665477 22:39243783-39243805 CGTCAGGCTCGCGGGCTGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1183665465_1183665478 8 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665478 22:39243784-39243806 GTCAGGCTCGCGGGCTGCAAGGG 0: 1
1: 0
2: 1
3: 4
4: 85
1183665465_1183665479 26 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665479 22:39243802-39243824 AAGGGTCCAAAGTTCACTGCAGG 0: 1
1: 0
2: 2
3: 11
4: 135
1183665465_1183665470 -9 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665470 22:39243767-39243789 GTCACCCAGCGCCCGGCGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1183665465_1183665473 -2 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665473 22:39243774-39243796 AGCGCCCGGCGTCAGGCTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51
1183665465_1183665480 27 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665480 22:39243803-39243825 AGGGTCCAAAGTTCACTGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 126
1183665465_1183665474 -1 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665474 22:39243775-39243797 GCGCCCGGCGTCAGGCTCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665465 Original CRISPR CTGGGTGACCTCTTCGGGCT GGG (reversed) Intronic
900194973 1:1371482-1371504 CAGGGTGAGCTCTGCAGGCTGGG + Intergenic
900798553 1:4724114-4724136 CTGGGTGGCCTCCCCAGGCTGGG + Intronic
900807773 1:4779051-4779073 CTCGGTGACATCTTCGGTATGGG - Intronic
900828048 1:4942211-4942233 CTTGGTGACCTCTTGGGGAGGGG - Intergenic
901459319 1:9382310-9382332 CTGGGTGAACTCTGCAGGCATGG - Intergenic
901735298 1:11308540-11308562 CTGGGTGGCCAATTTGGGCTGGG - Intergenic
902082601 1:13831359-13831381 CTCTGTGACCTCTTAGGCCTGGG + Intergenic
902940835 1:19799517-19799539 CTGGGTGACCTCTAAGAACTCGG + Intronic
904319996 1:29690357-29690379 CCAGGTGACCCCCTCGGGCTGGG + Intergenic
906169008 1:43707881-43707903 CTGGATGACCTCTCCTGGGTGGG + Intronic
909726331 1:78840600-78840622 CTGTGGGAGCTCTTCGGGGTTGG - Intergenic
915543262 1:156582067-156582089 CTGGGTGAGACCTTCGGGCAGGG + Exonic
921185739 1:212667810-212667832 CTGGGTGACATCTTCCTTCTGGG + Intergenic
922057905 1:222059060-222059082 CTTTGTGACCTCTTCCGGCAAGG + Intergenic
922618646 1:226977735-226977757 CTGGGTGGCCACTTTGGGCTGGG - Intronic
1065869968 10:29947796-29947818 CAGGGTGTCCTCTTCTGTCTAGG - Intergenic
1081974513 11:47223875-47223897 CTGGGGGACCTCTTGAGGCCAGG + Intronic
1083098509 11:60278857-60278879 CTGGGTGACCTCATCCCTCTGGG + Intergenic
1083293324 11:61701729-61701751 CTGTGTGACCTCAGCAGGCTCGG - Intronic
1083431413 11:62615391-62615413 CTGGGTAACTTATTGGGGCTGGG - Exonic
1083816427 11:65134795-65134817 CTGAGTGGCCTCCTCGGACTGGG + Intergenic
1084147822 11:67274417-67274439 GTGGGTGACCCCTACAGGCTGGG + Intronic
1084953394 11:72678893-72678915 CTGGGTGACTCCCTCTGGCTGGG + Intergenic
1088744937 11:112797354-112797376 ATGGTTGACCTCTGGGGGCTGGG + Intergenic
1089149479 11:116353854-116353876 CTGGGTGACCTCTCCTGGAGAGG - Intergenic
1089316471 11:117594589-117594611 CTGGGTGTCCCCAGCGGGCTGGG + Intronic
1091261109 11:134234954-134234976 CTGGGTGATCTCTCCAGGCCGGG - Exonic
1103087646 12:118073850-118073872 CTGGATGATCACCTCGGGCTGGG + Exonic
1103188468 12:118981169-118981191 CTGGGTGCCCCCTTTGGGCCAGG - Intergenic
1105958410 13:25305885-25305907 CTTGGAGAACTCTTCTGGCTTGG + Intronic
1106113705 13:26798956-26798978 CAGTATGACCTCTGCGGGCTTGG + Intergenic
1111221046 13:85205724-85205746 CTGGGTTGCCTCTGCTGGCTTGG - Intergenic
1113849136 13:113408010-113408032 CTGGGTGGCCTCCTGGGTCTGGG + Intergenic
1114503347 14:23188695-23188717 CTGGAGGAACTCTTCAGGCTAGG - Intronic
1116493783 14:45536682-45536704 CTGGGTGACCACTTCTGCCCTGG + Intergenic
1120027420 14:79601894-79601916 GTGGCTGCCCTCTTCGGTCTGGG - Intronic
1122077480 14:99245719-99245741 GTGGGTGACCTTCTCGGGCATGG - Intronic
1122636868 14:103134133-103134155 CTGGGGGGCCTCTGCGGCCTAGG + Intronic
1122795820 14:104205697-104205719 CTGGGTGAGGTCTGGGGGCTGGG + Intergenic
1123054888 14:105564650-105564672 CTGGGTGCCCGAGTCGGGCTGGG + Intergenic
1123079331 14:105684229-105684251 CTGGGTGCCCGAGTCGGGCTGGG + Intergenic
1123122468 14:105923750-105923772 CTGGGTGCCCTCCTGGGTCTGGG + Intronic
1123405114 15:20015174-20015196 CTGGGTGCCCTCCTGGGTCTGGG + Intergenic
1123514445 15:21021822-21021844 CTGGGTGCCCTCCTGGGTCTGGG + Intergenic
1124203325 15:27697031-27697053 GTGGGAGGCCTCTTCGTGCTTGG - Intergenic
1127714605 15:61637430-61637452 CTGGGTAACCTCTTCTGGCCTGG - Intergenic
1129223838 15:74153866-74153888 CTGGCTGACCTCTTGGGCATGGG - Intergenic
1130237700 15:82152162-82152184 CTGGGTGACTTCTTCTGGAAGGG + Exonic
1132061122 15:98693184-98693206 CTGGGAGACCTGTTTGGTCTTGG + Intronic
1136050512 16:27646821-27646843 CTGGGTGACCTCATGGAGCAAGG - Intronic
1136088800 16:27903772-27903794 CTGGGGGACTTCCTGGGGCTGGG - Intronic
1145868541 17:28255993-28256015 CTGGCTCACCTCCTCGGGCCTGG + Intergenic
1146329569 17:31916809-31916831 CGGGGTCACCTCTTTGGCCTAGG + Intergenic
1150445604 17:65225181-65225203 CTTGGAGAGCTCATCGGGCTTGG + Exonic
1153501252 18:5752186-5752208 TTGTCTGACCTCTTCAGGCTGGG + Intergenic
1160571272 18:79819172-79819194 CTGGGTGCCCTCGCCGGCCTTGG - Intergenic
1161346710 19:3771895-3771917 CAGGCTGTCCTCCTCGGGCTTGG + Exonic
1162302862 19:9854137-9854159 CTGGGGGGCCTCTGGGGGCTGGG - Exonic
1163605873 19:18274974-18274996 CTGGATCACCTCCTGGGGCTGGG + Intergenic
1167309604 19:48729331-48729353 CCGGGCGACCTCCTGGGGCTGGG - Exonic
931265906 2:60660425-60660447 CTGGGTGACCTGTCCAGCCTGGG - Intergenic
931947386 2:67325132-67325154 CTGGATGACATCTGAGGGCTCGG + Intergenic
933157569 2:78992713-78992735 CAGGGTAGCCTCTTGGGGCTCGG - Intergenic
934762742 2:96865394-96865416 CTGGGTGAGTCCTTGGGGCTTGG - Intronic
937645084 2:124257665-124257687 CTGGGTCATCTCTTCGGACTTGG + Intronic
944855565 2:203763911-203763933 CTGGGTGACCTCTGGGTGTTTGG + Intergenic
1168819180 20:761789-761811 CTGGGGGTCCTCTCCGTGCTTGG - Exonic
1172594695 20:36142683-36142705 CTGGGTGGCCTGATGGGGCTGGG + Intronic
1173105162 20:40126995-40127017 CTAGGTGACCTCTAAGTGCTAGG - Intergenic
1179995055 21:44970429-44970451 CTGGGTTACCTGTTGGTGCTCGG - Intronic
1180077053 21:45468287-45468309 CTGGGTGACCTGCTGGGGCGGGG - Exonic
1180147272 21:45928453-45928475 CTGGGTGAACTCTTAGGGGAGGG + Intronic
1181371921 22:22425634-22425656 CTGGGTGGCTTCTTGAGGCTGGG - Intergenic
1181871890 22:25905985-25906007 CTGGGGGACCACTTAGTGCTCGG + Intronic
1183665465 22:39243753-39243775 CTGGGTGACCTCTTCGGGCTGGG - Intronic
1184100310 22:42338490-42338512 CTGAGCGAGCTCTTCGGGATTGG - Intronic
1184499246 22:44861922-44861944 CTTGGTGACCTCTCTGGCCTCGG - Intronic
950112806 3:10430870-10430892 CTTGGTGGCCTCTTGGGGCTTGG + Intronic
964791144 3:160453694-160453716 CTGGGTAACTTATTGGGGCTGGG + Intronic
965521174 3:169669221-169669243 CTGGCCGCCCTCTCCGGGCTCGG + Intergenic
969295822 4:6270220-6270242 CCGGGTGACCCGTTCGGGCCCGG - Intronic
969306264 4:6327826-6327848 CTGAGAGACCCCTGCGGGCTGGG + Intronic
969402944 4:6968941-6968963 CTGGGTGACCTGTTAGGTGTAGG + Intronic
973271754 4:48269562-48269584 CTGGGTCCCCTCTTCGGTCCGGG - Intronic
974164905 4:58189710-58189732 CTGGTTGACCTCTCCTGTCTAGG + Intergenic
978235761 4:106457432-106457454 CTGGTAGAACTCTTTGGGCTTGG - Intergenic
982320549 4:154072688-154072710 CTGGGTGAGCTTTTGGGGCAGGG + Intergenic
985943983 5:3162655-3162677 TTGGGTGACCCCTTAGGGTTGGG - Intergenic
986353104 5:6898644-6898666 CTGGGGGATCTCTTGAGGCTAGG + Intergenic
986643824 5:9896918-9896940 CTGGATGACTTCTTGGGGATCGG - Intergenic
999453238 5:151694110-151694132 CAGGCTGACCTCTTTGGGATGGG + Intergenic
1001513609 5:172339767-172339789 CTGGGTCACCTCGTGGGGCAGGG + Exonic
1002416891 5:179125460-179125482 CTGGGAAACCTCTTCAGGCTAGG - Intronic
1003748166 6:9025200-9025222 CTGGGTTGCCTCTGCCGGCTCGG - Intergenic
1005412871 6:25568761-25568783 CTGTGTGACCTCTTCCCTCTAGG + Intronic
1007812740 6:44497863-44497885 CTTGGTGACTTCTTGGGGGTTGG - Intergenic
1010570367 6:77466730-77466752 CTGGGTCACCCCTTCGGAGTAGG + Intergenic
1017823300 6:158064257-158064279 CTGGTTGACCTCTCCTGGCTGGG + Intronic
1018769643 6:166959396-166959418 CTGGGTGGCTTCTTCAGGCTGGG - Intergenic
1018789658 6:167137504-167137526 CTGTGTGATCTCTTCAGGGTGGG + Exonic
1024284362 7:47744450-47744472 CTGGGGGAGCTCTTCGGCCCTGG + Intronic
1026045748 7:66904349-66904371 CTGGGAGACGCCGTCGGGCTGGG - Intergenic
1029595052 7:101533314-101533336 CTGGGTGGCCTTCTTGGGCTGGG + Intronic
1032516217 7:132508245-132508267 CTGGAGGACCTCTTCAAGCTGGG - Exonic
1034432677 7:151048970-151048992 CTGGGCCACGTCTTCGGGCCAGG + Exonic
1038443289 8:27586371-27586393 CTGGGTGGGCTCTTCTGGGTGGG - Intergenic
1056769701 9:89467929-89467951 CTGGGAGAGCCCTTGGGGCTGGG - Intronic
1060183743 9:121551442-121551464 CTGGGGGACCTTTGGGGGCTGGG - Intergenic
1060520597 9:124291978-124292000 CTGGGTCGCCTCTCTGGGCTGGG - Intronic
1060838761 9:126777983-126778005 CTGGATGACCTGGTTGGGCTGGG + Intergenic
1060903122 9:127279159-127279181 CTTGGTGACCTTTCCTGGCTGGG + Intronic
1061452649 9:130676949-130676971 CTGGGTGACCACTCCAGTCTGGG - Intronic
1062452573 9:136621737-136621759 CTGGGTGGGCTCGTGGGGCTGGG + Intergenic
1198750192 X:139931736-139931758 CTGGGGGCCGCCTTCGGGCTGGG - Intronic
1199457704 X:148047672-148047694 TTAGGTCACCTCTTGGGGCTGGG - Intergenic
1200234251 X:154460556-154460578 CTGGACGACCTCTTCAAGCTGGG + Exonic
1202068749 Y:20968591-20968613 CTGTGTGTGCTCTTAGGGCTTGG + Intergenic