ID: 1183665465

View in Genome Browser
Species Human (GRCh38)
Location 22:39243753-39243775
Sequence CTGGGTGACCTCTTCGGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 109}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665465_1183665478 8 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665478 22:39243784-39243806 GTCAGGCTCGCGGGCTGCAAGGG 0: 1
1: 0
2: 1
3: 4
4: 85
1183665465_1183665474 -1 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665474 22:39243775-39243797 GCGCCCGGCGTCAGGCTCGCGGG 0: 1
1: 0
2: 1
3: 11
4: 61
1183665465_1183665470 -9 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665470 22:39243767-39243789 GTCACCCAGCGCCCGGCGTCAGG 0: 1
1: 0
2: 0
3: 7
4: 73
1183665465_1183665477 7 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665477 22:39243783-39243805 CGTCAGGCTCGCGGGCTGCAAGG 0: 1
1: 0
2: 0
3: 6
4: 75
1183665465_1183665480 27 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665480 22:39243803-39243825 AGGGTCCAAAGTTCACTGCAGGG 0: 1
1: 0
2: 2
3: 9
4: 126
1183665465_1183665479 26 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665479 22:39243802-39243824 AAGGGTCCAAAGTTCACTGCAGG 0: 1
1: 0
2: 2
3: 11
4: 135
1183665465_1183665473 -2 Left 1183665465 22:39243753-39243775 CCCAGCCCGAAGAGGTCACCCAG 0: 1
1: 0
2: 0
3: 7
4: 109
Right 1183665473 22:39243774-39243796 AGCGCCCGGCGTCAGGCTCGCGG 0: 1
1: 0
2: 1
3: 4
4: 51

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665465 Original CRISPR CTGGGTGACCTCTTCGGGCT GGG (reversed) Intronic