ID: 1183665672

View in Genome Browser
Species Human (GRCh38)
Location 22:39244515-39244537
Sequence AGTTTGCACCTCTCCCTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 183}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665672_1183665679 -2 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665679 22:39244536-39244558 CTCCCGCCCGGGCCGGGTAGGGG 0: 1
1: 0
2: 1
3: 12
4: 161
1183665672_1183665686 4 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665686 22:39244542-39244564 CCCGGGCCGGGTAGGGGGGCGGG 0: 1
1: 0
2: 5
3: 49
4: 646
1183665672_1183665684 3 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665684 22:39244541-39244563 GCCCGGGCCGGGTAGGGGGGCGG 0: 1
1: 0
2: 2
3: 88
4: 806
1183665672_1183665675 -9 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665675 22:39244529-39244551 GTGCAAACTCCCGCCCGGGCCGG 0: 1
1: 0
2: 1
3: 7
4: 64
1183665672_1183665676 -8 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665676 22:39244530-39244552 TGCAAACTCCCGCCCGGGCCGGG 0: 1
1: 0
2: 0
3: 3
4: 101
1183665672_1183665692 27 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665692 22:39244565-39244587 AGCGTGTGCGCCCTGGCGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 63
1183665672_1183665689 20 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665689 22:39244558-39244580 GGGCGGGAGCGTGTGCGCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 217
1183665672_1183665680 -1 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665680 22:39244537-39244559 TCCCGCCCGGGCCGGGTAGGGGG 0: 1
1: 0
2: 1
3: 13
4: 137
1183665672_1183665690 25 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665690 22:39244563-39244585 GGAGCGTGTGCGCCCTGGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 144
1183665672_1183665682 0 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665682 22:39244538-39244560 CCCGCCCGGGCCGGGTAGGGGGG 0: 1
1: 0
2: 2
3: 30
4: 280
1183665672_1183665677 -4 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665677 22:39244534-39244556 AACTCCCGCCCGGGCCGGGTAGG 0: 1
1: 0
2: 1
3: 4
4: 64
1183665672_1183665678 -3 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665678 22:39244535-39244557 ACTCCCGCCCGGGCCGGGTAGGG 0: 1
1: 0
2: 1
3: 5
4: 99
1183665672_1183665691 26 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665672 Original CRISPR AGTTTGCACCTCTCCCTGCC CGG (reversed) Exonic