ID: 1183665683

View in Genome Browser
Species Human (GRCh38)
Location 22:39244539-39244561
Sequence GCCCCCCTACCCGGCCCGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 252}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665683_1183665690 1 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665690 22:39244563-39244585 GGAGCGTGTGCGCCCTGGCGCGG 0: 1
1: 0
2: 0
3: 10
4: 144
1183665683_1183665694 9 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665694 22:39244571-39244593 TGCGCCCTGGCGCGGGGCCCGGG 0: 1
1: 0
2: 2
3: 19
4: 300
1183665683_1183665700 21 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665700 22:39244583-39244605 CGGGGCCCGGGCGGCGGGCACGG 0: 1
1: 0
2: 6
3: 133
4: 843
1183665683_1183665689 -4 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665689 22:39244558-39244580 GGGCGGGAGCGTGTGCGCCCTGG 0: 1
1: 0
2: 1
3: 25
4: 217
1183665683_1183665695 12 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665695 22:39244574-39244596 GCCCTGGCGCGGGGCCCGGGCGG 0: 1
1: 0
2: 5
3: 63
4: 551
1183665683_1183665698 15 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665698 22:39244577-39244599 CTGGCGCGGGGCCCGGGCGGCGG 0: 1
1: 0
2: 8
3: 107
4: 738
1183665683_1183665691 2 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665683_1183665699 16 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665699 22:39244578-39244600 TGGCGCGGGGCCCGGGCGGCGGG 0: 1
1: 1
2: 6
3: 85
4: 627
1183665683_1183665693 8 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665693 22:39244570-39244592 GTGCGCCCTGGCGCGGGGCCCGG 0: 1
1: 0
2: 0
3: 29
4: 299
1183665683_1183665692 3 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665692 22:39244565-39244587 AGCGTGTGCGCCCTGGCGCGGGG 0: 1
1: 0
2: 0
3: 7
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665683 Original CRISPR GCCCCCCTACCCGGCCCGGG CGG (reversed) Exonic