ID: 1183665691

View in Genome Browser
Species Human (GRCh38)
Location 22:39244564-39244586
Sequence GAGCGTGTGCGCCCTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665688_1183665691 -7 Left 1183665688 22:39244548-39244570 CCGGGTAGGGGGGCGGGAGCGTG 0: 1
1: 0
2: 1
3: 23
4: 952
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665672_1183665691 26 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665685_1183665691 -1 Left 1183665685 22:39244542-39244564 CCCGGGCCGGGTAGGGGGGCGGG 0: 1
1: 1
2: 3
3: 92
4: 983
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665681_1183665691 3 Left 1183665681 22:39244538-39244560 CCCGCCCGGGCCGGGTAGGGGGG 0: 1
1: 0
2: 3
3: 37
4: 371
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665687_1183665691 -2 Left 1183665687 22:39244543-39244565 CCGGGCCGGGTAGGGGGGCGGGA 0: 1
1: 0
2: 3
3: 33
4: 337
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665671_1183665691 27 Left 1183665671 22:39244514-39244536 CCCGGGCAGGGAGAGGTGCAAAC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665683_1183665691 2 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665691 Original CRISPR GAGCGTGTGCGCCCTGGCGC GGG Exonic
900116826 1:1032685-1032707 GAGCAGAAGCGCCCTGGCGCCGG + Intronic
900243507 1:1627576-1627598 GAGCCTGTGCGTCCTGGGGTCGG + Intronic
900953860 1:5874975-5874997 GAGCGTGTGCTCCGTGGTGATGG + Exonic
901209497 1:7516440-7516462 GGGCGTGTGTGCACTGGCTCTGG - Intronic
901220130 1:7578991-7579013 GAGGCTGTGCTCCCTGGAGCAGG - Intronic
901325196 1:8361201-8361223 GAGGGCGTGGGCCCTGGCGTGGG + Exonic
901500835 1:9651924-9651946 CAGCCCGTGCGCCCTGGCCCTGG + Intronic
902409768 1:16206013-16206035 CAGCGTGTGCGACGTGGTGCTGG - Exonic
903060087 1:20663349-20663371 GAGTGTGTGCTCCTTGGCCCAGG + Intergenic
907119733 1:51998002-51998024 GACAGTGTGTGCCCTGGCGATGG - Intergenic
911002572 1:93180885-93180907 GAGCGACTGCGCCTTGGCGTGGG + Intronic
912386783 1:109274737-109274759 GAGCCTGTGCCCCCAGGCGGGGG + Exonic
914222859 1:145696002-145696024 GAGCCTGTGGGCCCTGACACTGG - Intronic
920841702 1:209560892-209560914 GAGCTTTTGGGCCCTGGCCCAGG + Intergenic
923689201 1:236176432-236176454 GAACGTGTGTGCCCTGGAGGAGG - Intronic
1066432243 10:35363030-35363052 GAGCGTCTCCGCCCGGCCGCCGG - Intronic
1072248955 10:93566891-93566913 CAACGTGTGCGCCCTGGTGCTGG + Exonic
1075031060 10:119025182-119025204 CAGGGTTTGCACCCTGGCGCTGG - Intergenic
1075520911 10:123143062-123143084 GAGCGTGGGAGCCCTGCGGCTGG - Intergenic
1077158990 11:1104101-1104123 CAGCGCGTGGGGCCTGGCGCTGG + Intergenic
1078315947 11:10293772-10293794 CAGCGGGTGCGCCCAGGGGCTGG + Intronic
1079135142 11:17772221-17772243 GTGCGTGTGCTCACTGGCGCTGG - Exonic
1083729206 11:64643762-64643784 GAGCGCGCGCGTCCAGGCGCGGG - Intronic
1083828567 11:65216998-65217020 GAGGCTGTGCGCTCTGGCCCTGG + Intergenic
1083952803 11:65966197-65966219 GAGCGTGGACGACCTGGCGCAGG + Exonic
1084888683 11:72225749-72225771 GAGTGTTTGAGCCCTGGCTCTGG + Intronic
1085019063 11:73193657-73193679 GACCGTGTGCTCCATGGAGCAGG - Intergenic
1085465262 11:76719360-76719382 GAGCGTGTGCACCCCTGCCCCGG + Intergenic
1092193115 12:6534285-6534307 GAGCGTGTGGGCCCCGACGTAGG - Exonic
1096583086 12:52601074-52601096 GAGGGTGCGCGCCCAGGAGCGGG - Exonic
1100600689 12:96109195-96109217 GGGCCTGGGCGCCCTGGAGCAGG - Intergenic
1101479702 12:105084751-105084773 GAGCCTGTGGGCCCTGACCCTGG + Intergenic
1104974389 12:132545968-132545990 GAGGGAGTGCGCCCTGGAGGTGG - Intronic
1111841359 13:93454813-93454835 GGGAGTGGGCGCCCTGGAGCAGG + Intronic
1111951272 13:94711378-94711400 GTGCGTGTGCCCCCCGGCGGCGG + Exonic
1112041474 13:95552599-95552621 TCGCGTGCGCCCCCTGGCGCCGG + Intronic
1113103432 13:106746326-106746348 GTGCGTGTGCCTCTTGGCGCTGG + Intergenic
1113820660 13:113209878-113209900 GAGCGGGGGCGCCGGGGCGCCGG + Intronic
1114736771 14:25050212-25050234 GAGCCCGAGCGCCCTGGCCCGGG + Exonic
1118667524 14:68086508-68086530 GAGCGCGTGGTCCCTGGCGAGGG - Intronic
1122140251 14:99659367-99659389 GAGCCCGTGAGCCCTGGCTCAGG + Intronic
1122191483 14:100047477-100047499 GAGAGTGTGAGCTCTGGCTCTGG - Intronic
1122578153 14:102754952-102754974 GAGCCTGAGCGCCCTGGAGGAGG - Intergenic
1122864637 14:104598001-104598023 GGCCGTGTGCGCCCTGGCAGAGG - Intronic
1122983621 14:105202414-105202436 GAGGGTGTTGGCCCTGGAGCAGG + Intergenic
1124014219 15:25862606-25862628 GAGCGAGCGCGCGGTGGCGCAGG - Intronic
1132235075 15:100213802-100213824 GTGCGTGTGCTCCCAGGTGCAGG - Intronic
1132562705 16:605136-605158 GATCGTGTGAGCCCTGGAGTTGG + Intronic
1132603938 16:785864-785886 GAGCGTCTGCTCACTGGCTCTGG - Exonic
1132674599 16:1116502-1116524 GAGCGTGTGCTCCCTAGAACTGG + Intergenic
1132681114 16:1142121-1142143 GAGTGTGAGTGCCGTGGCGCAGG - Intergenic
1133035015 16:3029559-3029581 GTGCGTCGGCGCCCTGGCCCTGG + Exonic
1133211075 16:4263809-4263831 GGGCGTGTGCGCCAGGGGGCGGG + Intronic
1138252069 16:55509184-55509206 GAGCCGGTGCGCCCAGGCGGCGG + Exonic
1138327941 16:56191244-56191266 GCGCGTGTGCGCGCCGCCGCCGG + Intergenic
1141340581 16:83200192-83200214 GAGGGTGTGAGCCTGGGCGCTGG + Intronic
1141370003 16:83478249-83478271 GAGCGTGTGCCTCCTGCCTCAGG - Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143247670 17:5500149-5500171 GAGGGTCGGCGCCCTGGCCCGGG - Intronic
1143510384 17:7392440-7392462 GAGTGTGTGAGCCCAGGCCCTGG - Intronic
1146089940 17:29866917-29866939 GATCGTGTGAGCCCTGGTGATGG - Intronic
1147726496 17:42568889-42568911 GAGTGTGTGCGCGCCGCCGCCGG - Exonic
1147900283 17:43779058-43779080 GAGCGCGGGCGCCGTGACGCGGG + Intergenic
1151370751 17:73644932-73644954 GAGGCTCTGCGCCCGGGCGCCGG - Intergenic
1152588816 17:81201158-81201180 GAACGTGTGAGCCCTAGCTCGGG + Intronic
1154346733 18:13548790-13548812 GGCCGTGTGCTCCCTGGAGCAGG - Intronic
1157599417 18:48885046-48885068 GAGAGTGTGTGGCCTGGGGCAGG + Intergenic
1160369956 18:78363713-78363735 GAGGGTGTGCGCCCCGGGGTCGG - Intergenic
1160519598 18:79496958-79496980 GAGCATGCGGGCCTTGGCGCTGG - Intronic
1160714976 19:572462-572484 GAGCGTGTGCGCGCGTGCGCAGG + Intronic
1161576374 19:5056795-5056817 GAGTGTGGGAGCCCTGGGGCGGG + Intronic
1162975895 19:14206826-14206848 GAGCGGGTGCGCCGGGGAGCGGG - Intergenic
1163671754 19:18633448-18633470 GAGGGTGTGAGCCCTGCAGCTGG + Intergenic
1163831762 19:19550454-19550476 GAGCGGGTCGGCCCTGGGGCTGG + Intergenic
1165231942 19:34392887-34392909 GAGGAGGTGGGCCCTGGCGCAGG + Intronic
1168234219 19:55051817-55051839 GATCGTTTGAGCCCTGGCGGCGG - Intronic
929189273 2:39124309-39124331 CGACGGGTGCGCCCTGGCGCAGG + Intronic
935598756 2:104900804-104900826 GAGGGTGTGCCACTTGGCGCAGG - Intergenic
936805456 2:116326510-116326532 GAGAGTGTGGGCCCTGCAGCTGG + Intergenic
942045085 2:172095356-172095378 CAGCTTGTGCGCTCTGGCCCGGG + Intergenic
942458321 2:176152442-176152464 GAGCGTGTGCGCCGGGGAGAGGG + Intronic
943488086 2:188514075-188514097 GTGTGTGTGCGCCCTGCCACTGG + Intronic
945699439 2:213151849-213151871 GCGCGTGTGCGCGCGCGCGCGGG + Intronic
947906435 2:233766586-233766608 GAGGGTGTGGTCCCTGGCGAGGG - Intronic
1169088169 20:2840177-2840199 GAGCGGGTGCGCGCATGCGCGGG - Intronic
1169118622 20:3082820-3082842 GAGCACGGGCGCCCTGGGGCGGG + Intronic
1172539466 20:35699597-35699619 GAAAGTGTGGGCCCAGGCGCTGG - Intronic
1172751603 20:37255374-37255396 GAGCCATTGCGCCCTGGCCCAGG - Intronic
1176097994 20:63353046-63353068 CAGCCTGTGGGCCCTGGAGCAGG - Intronic
1176100972 20:63364381-63364403 GAGCGTGTGCACTCGGCCGCAGG - Intronic
1176124949 20:63471230-63471252 GAGAGCAAGCGCCCTGGCGCGGG + Intronic
1176728512 21:10465672-10465694 GAGCGGGTTCTCCCTGGAGCTGG + Intergenic
1177225181 21:18244847-18244869 GAGCCGGTGCGCCCTGGTCCTGG - Exonic
1179712968 21:43273604-43273626 GAGCGTGAGCCCCCAGGCCCTGG - Intergenic
1183444491 22:37844157-37844179 GGGCGAGTGCGCGGTGGCGCCGG - Exonic
1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG + Exonic
950098193 3:10342326-10342348 GAGCGTGTATGCCCTGCCCCAGG + Intronic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
951571909 3:24072865-24072887 GAGGGTGGGCGCCGTGGCTCAGG - Intergenic
955916506 3:63912755-63912777 GGCCGTGTGCGCCGTGGCGGCGG - Exonic
961674261 3:128555354-128555376 GATCCTGTGCGCCCTGCCTCGGG + Intergenic
963799042 3:149658521-149658543 GCCCGGGTGCGCCCCGGCGCGGG + Intronic
967875338 3:194265035-194265057 CAGTGTGTGCTCCCTGGCCCGGG + Intergenic
968640460 4:1712079-1712101 GAGCGCGTGCCCCGTGGGGCGGG - Intronic
968873196 4:3251905-3251927 GAGCGTGTGAGGGCAGGCGCTGG - Intronic
975071507 4:70145428-70145450 GAGCGTTTGAGCCCTTGGGCTGG - Intronic
979169032 4:117576028-117576050 CAGCGTGTGCGCCCTGGTGGCGG - Intergenic
983064034 4:163189741-163189763 GAGACTGGGCGCCCTGGAGCAGG + Intergenic
983919816 4:173333838-173333860 GAGGGTGTGCGCCGGGGCGCGGG - Intronic
998903422 5:146878682-146878704 GAGGGTGAGTGCGCTGGCGCCGG - Intronic
1003284785 6:4725312-4725334 GAGTGTGGGCGCACAGGCGCAGG - Intronic
1007917088 6:45571406-45571428 GAGTGTGAGGGCCCTGGGGCAGG + Intronic
1019125719 6:169839064-169839086 GAGCGTGAGGGCCGTGGCGCAGG + Intergenic
1019410318 7:903928-903950 GGGAGTGTGGGCACTGGCGCCGG - Intronic
1019595537 7:1856732-1856754 GTGCGCGTGGGCCCTGCCGCTGG - Intronic
1020078499 7:5274186-5274208 GAGGGTGAGCGCCCTGCCCCAGG + Intergenic
1022734394 7:33062639-33062661 CAGCGTGTGCGCCCTGGTGGCGG - Exonic
1022741748 7:33129062-33129084 CAGCGTGTGCGCCCTGGTGGCGG - Intergenic
1030869101 7:114733632-114733654 GAGCTGTTGCGCCCTGGGGCAGG + Intergenic
1032019066 7:128396561-128396583 GAGCGAGTGCCCGCTGGCCCCGG - Intronic
1036665197 8:10733108-10733130 AAGCGAGCGCGCCCTGGTGCAGG + Intronic
1037305248 8:17497319-17497341 GGGCGAGGGCGCCCTGGGGCCGG + Intronic
1038157050 8:25000707-25000729 GAGCCTGAGCTCCCCGGCGCTGG - Intergenic
1039608398 8:38901126-38901148 GAGGGGGTGCGGCCGGGCGCCGG - Intergenic
1040360268 8:46658475-46658497 GAGCTTTTGGGCCCTGGGGCAGG - Intergenic
1047336277 8:123939754-123939776 CAGCGTGTGCTCCCTGTAGCTGG + Intronic
1049259113 8:141629388-141629410 GAGCCTGTGCTGCCTGCCGCTGG + Intergenic
1049642026 8:143720126-143720148 GAGGCTGTGCTCCCTGGGGCTGG + Intronic
1056413493 9:86354619-86354641 GAGCGAGTGCGCTGGGGCGCCGG - Intergenic
1060051756 9:120383151-120383173 GTGTGTGCGCGCCCTGGCGGCGG - Intergenic
1061488328 9:130931623-130931645 GAGCGTGTGCGGCCACGCTCTGG - Intronic
1062615764 9:137395051-137395073 CAGCGTGGGTGGCCTGGCGCCGG - Intronic
1202800813 9_KI270719v1_random:174396-174418 CAGCTTGTGCGCCCAGGCGGCGG - Intergenic
1200089790 X:153629175-153629197 GAGCAAGTGCGCCCTGCCTCAGG + Intergenic