ID: 1183665691

View in Genome Browser
Species Human (GRCh38)
Location 22:39244564-39244586
Sequence GAGCGTGTGCGCCCTGGCGC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 134
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 124}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183665687_1183665691 -2 Left 1183665687 22:39244543-39244565 CCGGGCCGGGTAGGGGGGCGGGA 0: 1
1: 0
2: 3
3: 33
4: 337
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665685_1183665691 -1 Left 1183665685 22:39244542-39244564 CCCGGGCCGGGTAGGGGGGCGGG 0: 1
1: 1
2: 3
3: 92
4: 983
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665672_1183665691 26 Left 1183665672 22:39244515-39244537 CCGGGCAGGGAGAGGTGCAAACT 0: 1
1: 0
2: 0
3: 16
4: 183
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665683_1183665691 2 Left 1183665683 22:39244539-39244561 CCGCCCGGGCCGGGTAGGGGGGC 0: 1
1: 0
2: 2
3: 17
4: 252
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665688_1183665691 -7 Left 1183665688 22:39244548-39244570 CCGGGTAGGGGGGCGGGAGCGTG 0: 1
1: 0
2: 1
3: 23
4: 952
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665671_1183665691 27 Left 1183665671 22:39244514-39244536 CCCGGGCAGGGAGAGGTGCAAAC 0: 1
1: 0
2: 1
3: 18
4: 234
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124
1183665681_1183665691 3 Left 1183665681 22:39244538-39244560 CCCGCCCGGGCCGGGTAGGGGGG 0: 1
1: 0
2: 3
3: 37
4: 371
Right 1183665691 22:39244564-39244586 GAGCGTGTGCGCCCTGGCGCGGG 0: 1
1: 0
2: 0
3: 9
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183665691 Original CRISPR GAGCGTGTGCGCCCTGGCGC GGG Exonic