ID: 1183667282

View in Genome Browser
Species Human (GRCh38)
Location 22:39253250-39253272
Sequence CATCAAAACAGGAAGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183667282_1183667290 23 Left 1183667282 22:39253250-39253272 CCCAGCTCCTTCCTGTTTTGATG No data
Right 1183667290 22:39253296-39253318 CCTTCTTTATTTTTCCAGACGGG No data
1183667282_1183667288 22 Left 1183667282 22:39253250-39253272 CCCAGCTCCTTCCTGTTTTGATG No data
Right 1183667288 22:39253295-39253317 TCCTTCTTTATTTTTCCAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183667282 Original CRISPR CATCAAAACAGGAAGGAGCT GGG (reversed) Intergenic
No off target data available for this crispr