ID: 1183668413

View in Genome Browser
Species Human (GRCh38)
Location 22:39257950-39257972
Sequence CGGGATGTCCAACCTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183668413_1183668415 -10 Left 1183668413 22:39257950-39257972 CCAAGACCAGGTTGGACATCCCG No data
Right 1183668415 22:39257963-39257985 GGACATCCCGCCTCTCTAGAAGG No data
1183668413_1183668420 10 Left 1183668413 22:39257950-39257972 CCAAGACCAGGTTGGACATCCCG No data
Right 1183668420 22:39257983-39258005 AGGCCCCTCCAACCCAGCGTGGG No data
1183668413_1183668419 9 Left 1183668413 22:39257950-39257972 CCAAGACCAGGTTGGACATCCCG No data
Right 1183668419 22:39257982-39258004 AAGGCCCCTCCAACCCAGCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183668413 Original CRISPR CGGGATGTCCAACCTGGTCT TGG (reversed) Intergenic
No off target data available for this crispr