ID: 1183671061

View in Genome Browser
Species Human (GRCh38)
Location 22:39273166-39273188
Sequence TGGGGAGCCCAGATCCAACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183671061_1183671067 -9 Left 1183671061 22:39273166-39273188 CCCTGTTGGATCTGGGCTCCCCA No data
Right 1183671067 22:39273180-39273202 GGCTCCCCAAGGGCAGGGCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183671061 Original CRISPR TGGGGAGCCCAGATCCAACA GGG (reversed) Intergenic
No off target data available for this crispr