ID: 1183671587

View in Genome Browser
Species Human (GRCh38)
Location 22:39276053-39276075
Sequence AGGTAGAAGCAGCAGGTGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183671579_1183671587 -10 Left 1183671579 22:39276040-39276062 CCACCCTGGCCCCAGGTAGAAGC No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671571_1183671587 15 Left 1183671571 22:39276015-39276037 CCCTTGATAGCTCTATGCCCCGC No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671566_1183671587 29 Left 1183671566 22:39276001-39276023 CCCCCGCCTCTGCTCCCTTGATA No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671568_1183671587 27 Left 1183671568 22:39276003-39276025 CCCGCCTCTGCTCCCTTGATAGC No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671569_1183671587 26 Left 1183671569 22:39276004-39276026 CCGCCTCTGCTCCCTTGATAGCT No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671575_1183671587 -3 Left 1183671575 22:39276033-39276055 CCCGCACCCACCCTGGCCCCAGG No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671577_1183671587 -4 Left 1183671577 22:39276034-39276056 CCGCACCCACCCTGGCCCCAGGT No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671572_1183671587 14 Left 1183671572 22:39276016-39276038 CCTTGATAGCTCTATGCCCCGCA No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671574_1183671587 -2 Left 1183671574 22:39276032-39276054 CCCCGCACCCACCCTGGCCCCAG No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671567_1183671587 28 Left 1183671567 22:39276002-39276024 CCCCGCCTCTGCTCCCTTGATAG No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671578_1183671587 -9 Left 1183671578 22:39276039-39276061 CCCACCCTGGCCCCAGGTAGAAG No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data
1183671570_1183671587 23 Left 1183671570 22:39276007-39276029 CCTCTGCTCCCTTGATAGCTCTA No data
Right 1183671587 22:39276053-39276075 AGGTAGAAGCAGCAGGTGGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183671587 Original CRISPR AGGTAGAAGCAGCAGGTGGC CGG Intergenic
No off target data available for this crispr