ID: 1183676316

View in Genome Browser
Species Human (GRCh38)
Location 22:39300721-39300743
Sequence GTGTGGCCATGAGGCCTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183676306_1183676316 25 Left 1183676306 22:39300673-39300695 CCGAGGCGGTGGCCAGCCTGCTG No data
Right 1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG No data
1183676309_1183676316 9 Left 1183676309 22:39300689-39300711 CCTGCTGCATTGCAGGAACAGAG No data
Right 1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG No data
1183676308_1183676316 13 Left 1183676308 22:39300685-39300707 CCAGCCTGCTGCATTGCAGGAAC No data
Right 1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG No data
1183676305_1183676316 26 Left 1183676305 22:39300672-39300694 CCCGAGGCGGTGGCCAGCCTGCT No data
Right 1183676316 22:39300721-39300743 GTGTGGCCATGAGGCCTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183676316 Original CRISPR GTGTGGCCATGAGGCCTGGG AGG Intergenic
No off target data available for this crispr