ID: 1183677476

View in Genome Browser
Species Human (GRCh38)
Location 22:39307568-39307590
Sequence TCACTTCTGTTTTCACAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183677476_1183677482 -7 Left 1183677476 22:39307568-39307590 CCTCCCTGTGAAAACAGAAGTGA No data
Right 1183677482 22:39307584-39307606 GAAGTGATGCCGGGGCTCAGTGG No data
1183677476_1183677489 30 Left 1183677476 22:39307568-39307590 CCTCCCTGTGAAAACAGAAGTGA No data
Right 1183677489 22:39307621-39307643 CCCAGCACTTTGGGAGGCCGAGG 0: 114360
1: 259489
2: 214307
3: 130302
4: 170463
1183677476_1183677487 24 Left 1183677476 22:39307568-39307590 CCTCCCTGTGAAAACAGAAGTGA No data
Right 1183677487 22:39307615-39307637 TGTAATCCCAGCACTTTGGGAGG 0: 288135
1: 266162
2: 155564
3: 133776
4: 191789
1183677476_1183677485 21 Left 1183677476 22:39307568-39307590 CCTCCCTGTGAAAACAGAAGTGA No data
Right 1183677485 22:39307612-39307634 ACCTGTAATCCCAGCACTTTGGG 0: 71908
1: 300079
2: 246221
3: 151210
4: 174122
1183677476_1183677484 20 Left 1183677476 22:39307568-39307590 CCTCCCTGTGAAAACAGAAGTGA No data
Right 1183677484 22:39307611-39307633 CACCTGTAATCCCAGCACTTTGG 0: 68945
1: 203244
2: 249087
3: 204446
4: 175427

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183677476 Original CRISPR TCACTTCTGTTTTCACAGGG AGG (reversed) Intergenic
No off target data available for this crispr