ID: 1183677683

View in Genome Browser
Species Human (GRCh38)
Location 22:39308969-39308991
Sequence CGCCTGCAGCGCGGAGACGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183677683_1183677689 11 Left 1183677683 22:39308969-39308991 CCAGCGTCTCCGCGCTGCAGGCG No data
Right 1183677689 22:39309003-39309025 GAGTCACTTTGTAGCCCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183677683 Original CRISPR CGCCTGCAGCGCGGAGACGC TGG (reversed) Intergenic
No off target data available for this crispr