ID: 1183679455

View in Genome Browser
Species Human (GRCh38)
Location 22:39319190-39319212
Sequence TGGGAGGTAAAGAAGCTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183679455_1183679463 9 Left 1183679455 22:39319190-39319212 CCCCCAAGCTTCTTTACCTCCCA No data
Right 1183679463 22:39319222-39319244 GCGCCGAGAACCTCCACCCAAGG 0: 1
1: 0
2: 0
3: 2
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183679455 Original CRISPR TGGGAGGTAAAGAAGCTTGG GGG (reversed) Intronic
No off target data available for this crispr