ID: 1183683643

View in Genome Browser
Species Human (GRCh38)
Location 22:39349820-39349842
Sequence CAGCGCGCGACCTCGGGCGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 68}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183683643 Original CRISPR CAGCGCGCGACCTCGGGCGC GGG (reversed) Intergenic
900662078 1:3789795-3789817 CAGCGTGCGACCTCGTCAGCAGG - Intronic
901373226 1:8817920-8817942 CAGCGCGAGCCCTCGAGCCCCGG - Intergenic
905232662 1:36524213-36524235 CAGCGGGCGGCCTCAGGCACAGG + Intergenic
905995940 1:42380709-42380731 CAGCGCGCGGCGGCGGGCGCTGG - Intergenic
906614542 1:47225481-47225503 CAGCGCGCGGCCGGGGGCGGCGG + Exonic
917565403 1:176207351-176207373 CAGGGCGCGCCCTCGGGGTCGGG + Exonic
919451288 1:197775438-197775460 CAGCGGGCGGCCCCGGTCGCAGG - Intronic
921024033 1:211260468-211260490 CAGCCCGCGGCCTCGGACCCTGG - Intronic
921384078 1:214551859-214551881 CAGCTCGGGAGCTCGGGAGCTGG - Intronic
922786005 1:228282586-228282608 AGGGGCGCGAACTCGGGCGCTGG - Intronic
924620605 1:245657314-245657336 CAGCGCGCGATTTCAGGCTCAGG - Intronic
1071309530 10:84329043-84329065 CAGCGCGGGGCCTCGGGCCGCGG + Intronic
1071603121 10:86968613-86968635 TAGCGCGCGACCTAGGGCTCAGG + Intronic
1076683817 10:132187804-132187826 CAGAGCGGGACCTCCCGCGCCGG - Intronic
1077419923 11:2445265-2445287 GGGCGCGGGACCTGGGGCGCCGG - Exonic
1082838171 11:57667102-57667124 GAGCGCGCGACCTGAGGCGGTGG - Intergenic
1084178666 11:67436081-67436103 CAGCCAGCGACCTGGGGGGCTGG + Exonic
1104980135 12:132570033-132570055 CAGGGCGCGGCATGGGGCGCGGG - Exonic
1105044052 12:132986817-132986839 CAGCGCGCGAACGTGGGCGTGGG + Exonic
1105471922 13:20703161-20703183 GAGCGCGCGACCCCAGGCCCTGG + Intronic
1113494027 13:110713941-110713963 CGGCCCGCGCCCTCAGGCGCTGG + Intronic
1116928630 14:50668104-50668126 CTGCGGGCGACCCCGGGCTCCGG - Exonic
1126140095 15:45430412-45430434 AAGCGCCCGAACGCGGGCGCTGG - Intergenic
1132527728 16:425932-425954 CAGGGCGCGGCGGCGGGCGCGGG - Exonic
1132572292 16:649415-649437 CCGCGCGCTACCTCGGGCCATGG - Exonic
1132837076 16:1959539-1959561 TAGCGGGCGACCTAGGCCGCGGG + Exonic
1132842314 16:1984130-1984152 CAGCGCGCGGCCACAGGAGCCGG - Intronic
1138265262 16:55655936-55655958 CGGCGCGTTACCTGGGGCGCAGG + Intronic
1140043701 16:71425905-71425927 GAGCGTGCGACCTCAGCCGCGGG - Intergenic
1141832240 16:86516211-86516233 CAGCGCGAAATCTCGGACGCGGG - Intergenic
1141989751 16:87602999-87603021 CGGAGCGCGGTCTCGGGCGCGGG - Exonic
1142156147 16:88533624-88533646 CAGGGCGCGGGCGCGGGCGCCGG + Exonic
1143615648 17:8047676-8047698 CAGCCTGCCACCTCGGGCGCTGG - Intronic
1144020926 17:11240179-11240201 CAGCGCGCTGCCCCGGGCTCCGG + Intergenic
1149461655 17:56834102-56834124 CAGCTCGCGGCCCCGCGCGCCGG + Exonic
1151591393 17:75047102-75047124 CCGCGCGGGTCCCCGGGCGCTGG + Intronic
1151954057 17:77372030-77372052 CAGCGAGCGACCTCAGACCCAGG + Intronic
1152627144 17:81393099-81393121 CGGCGCGCGAGCCCGAGCGCGGG - Intergenic
1152867963 17:82735533-82735555 CGGCGCGTGACCCCGGGCGGCGG - Intergenic
1155942280 18:31811320-31811342 CGGCGCGGGTCCTCCGGCGCGGG + Intergenic
1158453542 18:57587302-57587324 CAGTGTGCGACCTTGGGGGCGGG - Intergenic
1159045553 18:63366573-63366595 CGGCGCGCGGCCCCGGGCGGGGG - Intronic
1160706405 19:532143-532165 CCACGAGCGACCTCGGGCGCCGG + Intronic
925609886 2:5693616-5693638 GCCGGCGCGACCTCGGGCGCCGG + Exonic
935645312 2:105329630-105329652 CGGCGCGGGACGGCGGGCGCCGG - Exonic
937283868 2:120737575-120737597 CGGTGCGCGACCTCTGGCACGGG + Intronic
948645342 2:239400771-239400793 CGGCGCGCGGGCTCGGGCTCGGG + Exonic
1176016924 20:62938470-62938492 AGGCGCGCGGCCTCAGGCGCTGG + Intronic
1176547884 21:8209256-8209278 CCTCGCGCGCCCGCGGGCGCCGG + Intergenic
1181121527 22:20670787-20670809 CTGCGGGCCTCCTCGGGCGCTGG - Intergenic
1182490551 22:30668599-30668621 CAGCTCACCACCTAGGGCGCTGG - Intronic
1183683643 22:39349820-39349842 CAGCGCGCGACCTCGGGCGCGGG - Intergenic
968556411 4:1248392-1248414 CAGCGCGCGGCCACGGTCGCCGG + Intronic
969614651 4:8245205-8245227 CAGCGCCCGGCCTGGGGAGCAGG + Intergenic
985512712 5:321483-321505 CAGCGCGCGACCCCCGCCTCGGG + Intronic
985895625 5:2748794-2748816 CGGGGCGCGGCCTCGGGCGGGGG + Exonic
986330724 5:6714263-6714285 CGCCGCGCGCCCTCGGCCGCGGG - Intergenic
991720950 5:69493662-69493684 CAGCGCGCGCCCACGTTCGCCGG - Intronic
1002927280 6:1611682-1611704 CAGGGCGCGCCCGGGGGCGCGGG + Exonic
1004596213 6:17102165-17102187 GAGCGCGGGACCACCGGCGCCGG + Intergenic
1006785079 6:36660922-36660944 CGGCGCGCTAGCTCCGGCGCTGG + Intergenic
1008629339 6:53348610-53348632 CAGCCCGGCTCCTCGGGCGCGGG - Intronic
1010142160 6:72623271-72623293 CAGCGGGGAACCTGGGGCGCAGG + Intronic
1013472407 6:110476805-110476827 CACCATGCGACCGCGGGCGCCGG - Intergenic
1017738158 6:157381736-157381758 CAGCCCGCGTCCCGGGGCGCGGG - Exonic
1019426129 7:977677-977699 CAGAGTCCGACCTTGGGCGCAGG - Intergenic
1019989629 7:4682492-4682514 CCGGGCGCGATCGCGGGCGCGGG + Exonic
1022410422 7:30135358-30135380 CCGCGCGGGAGCTCGGGCGCAGG - Intronic
1030121054 7:106111758-106111780 CAGAGCGCGACGCCGGCCGCCGG + Intronic
1033159174 7:138981486-138981508 CAACGCGCGGGCCCGGGCGCGGG + Intergenic
1035553372 8:545673-545695 TATCCCGCGACCTCGGGCGCCGG - Exonic
1041689883 8:60678640-60678662 CGGCGCGCGGGCGCGGGCGCGGG + Intergenic
1061128302 9:128690044-128690066 CCGCGCGGGAGGTCGGGCGCGGG - Intronic
1061129832 9:128702696-128702718 GGGCGCGGGACCTCGGGCGTGGG + Exonic
1061680957 9:132242174-132242196 CACCGCCCGGCCTCGGACGCCGG - Exonic
1186660738 X:11665410-11665432 AGGCGCGCAACCTCGGGCGCCGG - Exonic
1189322574 X:40095766-40095788 CGGCGCGCGCCCTGGCGCGCGGG + Intronic