ID: 1183683689

View in Genome Browser
Species Human (GRCh38)
Location 22:39349946-39349968
Sequence CGCCGCGCACGCGCACGGGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 102}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183683669_1183683689 29 Left 1183683669 22:39349894-39349916 CCTCGCGGGAGCCCTGGGCCGCC 0: 1
1: 0
2: 4
3: 29
4: 281
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683668_1183683689 30 Left 1183683668 22:39349893-39349915 CCCTCGCGGGAGCCCTGGGCCGC 0: 1
1: 0
2: 0
3: 12
4: 169
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683671_1183683689 18 Left 1183683671 22:39349905-39349927 CCCTGGGCCGCCGGCCGCGCGCG 0: 1
1: 0
2: 1
3: 28
4: 191
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683682_1183683689 4 Left 1183683682 22:39349919-39349941 CCGCGCGCGCAGGGGAGGGGGCG 0: 1
1: 0
2: 4
3: 30
4: 279
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683672_1183683689 17 Left 1183683672 22:39349906-39349928 CCTGGGCCGCCGGCCGCGCGCGC 0: 1
1: 0
2: 12
3: 70
4: 524
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683678_1183683689 8 Left 1183683678 22:39349915-39349937 CCGGCCGCGCGCGCAGGGGAGGG 0: 1
1: 0
2: 2
3: 29
4: 221
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102
1183683676_1183683689 11 Left 1183683676 22:39349912-39349934 CCGCCGGCCGCGCGCGCAGGGGA 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1183683689 22:39349946-39349968 CGCCGCGCACGCGCACGGGCCGG 0: 1
1: 0
2: 2
3: 12
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183683689 Original CRISPR CGCCGCGCACGCGCACGGGC CGG Intronic