ID: 1183684398

View in Genome Browser
Species Human (GRCh38)
Location 22:39353230-39353252
Sequence CTGAAGCTTACATGATTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 248
Summary {0: 1, 1: 1, 2: 3, 3: 28, 4: 215}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183684398_1183684406 4 Left 1183684398 22:39353230-39353252 CCCCCAAATCATGTAAGCTTCAG 0: 1
1: 1
2: 3
3: 28
4: 215
Right 1183684406 22:39353257-39353279 TCACCAACCTGGACCCACCCTGG 0: 1
1: 0
2: 1
3: 20
4: 194
1183684398_1183684404 -7 Left 1183684398 22:39353230-39353252 CCCCCAAATCATGTAAGCTTCAG 0: 1
1: 1
2: 3
3: 28
4: 215
Right 1183684404 22:39353246-39353268 GCTTCAGGGCCTCACCAACCTGG 0: 1
1: 0
2: 0
3: 9
4: 158
1183684398_1183684413 28 Left 1183684398 22:39353230-39353252 CCCCCAAATCATGTAAGCTTCAG 0: 1
1: 1
2: 3
3: 28
4: 215
Right 1183684413 22:39353281-39353303 ACCCAAGCCCTCTGAGCCCCTGG 0: 1
1: 0
2: 4
3: 37
4: 360
1183684398_1183684415 29 Left 1183684398 22:39353230-39353252 CCCCCAAATCATGTAAGCTTCAG 0: 1
1: 1
2: 3
3: 28
4: 215
Right 1183684415 22:39353282-39353304 CCCAAGCCCTCTGAGCCCCTGGG 0: 1
1: 0
2: 4
3: 45
4: 362

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183684398 Original CRISPR CTGAAGCTTACATGATTTGG GGG (reversed) Intronic
900831499 1:4969086-4969108 CTGAAGCTCAAATGCTTTGCAGG - Intergenic
904501246 1:30913960-30913982 CTGAAGCTTATACGGTTTGAAGG + Intergenic
910544903 1:88404451-88404473 ATGAAGCTTAAATGTTTTGAAGG - Intergenic
911281120 1:95930375-95930397 CTGAATCTTGAATGATTTGTAGG + Intergenic
911402034 1:97387443-97387465 CTGAAGCTTACATTTTAGGGAGG + Intronic
912485464 1:110024042-110024064 CTGAAGCTTACATAACTTTGGGG - Intergenic
912996199 1:114534764-114534786 CGGGGGCATACATGATTTGGAGG - Intergenic
914419723 1:147518289-147518311 CTGAACCGTTTATGATTTGGGGG + Intergenic
915522031 1:156452036-156452058 CTGAAGCATGTATGATTTGAGGG + Intergenic
916295272 1:163212305-163212327 CTCCAGCCTACATGTTTTGGGGG - Intronic
917381952 1:174420995-174421017 ATGAAGCTTATATAATTTGGAGG + Intronic
917493526 1:175519018-175519040 TTGTAGTTAACATGATTTGGTGG - Intronic
922027600 1:221765913-221765935 TTGAAGCTTATACAATTTGGGGG - Intergenic
922329817 1:224564654-224564676 CTGGGGTTTACATGCTTTGGAGG + Intronic
923985762 1:239380084-239380106 CTGTAGCTTATACAATTTGGTGG - Intergenic
1064031658 10:11886829-11886851 CTGCAGCTTAGATGCTTTGAGGG + Intergenic
1065089235 10:22213559-22213581 CTAAAGCTTATATGATTTTTGGG - Intergenic
1065304828 10:24358019-24358041 GTGCAGCTTGCTTGATTTGGGGG - Intronic
1066015984 10:31244063-31244085 TTGAAGCTTAAACAATTTGGGGG + Intergenic
1066121123 10:32288750-32288772 CTGAGCCCTACATGATTTTGTGG - Intronic
1070748250 10:78948145-78948167 CTGAAACTTGCACAATTTGGGGG + Intergenic
1073304252 10:102490516-102490538 CTGTAGCTTAGACGTTTTGGAGG - Intronic
1074337367 10:112591720-112591742 CTGCAGATTACCTGACTTGGTGG + Intronic
1074365004 10:112850681-112850703 GTGACACTTATATGATTTGGGGG - Intergenic
1075167435 10:120081680-120081702 CTGAAATTTATATAATTTGGGGG - Intergenic
1076593432 10:131608451-131608473 CTGTAGCTTCTTTGATTTGGGGG - Intergenic
1077602218 11:3581551-3581573 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1077637177 11:3851170-3851192 CTGAAGCTTACAATATGTTGAGG + Intergenic
1078279093 11:9881644-9881666 CTGAAGCTGACATGACTTCTGGG - Intronic
1078791164 11:14543443-14543465 GTAAAGCATACATGATTCGGTGG + Intronic
1080160400 11:29168163-29168185 CTGTAGCTTACTTGATTTTCTGG + Intergenic
1080348265 11:31351196-31351218 CTGAAGTTTACATTATTTATTGG + Intronic
1081665707 11:44915964-44915986 CTGAAGCAGACTTGATGTGGTGG + Intronic
1083192179 11:61060203-61060225 CTGAAGCCTATACAATTTGGGGG + Intergenic
1084258119 11:67956101-67956123 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1084814631 11:71639113-71639135 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1085556233 11:77424705-77424727 CTGAAGATTAGAAGTTTTGGAGG - Intronic
1086208323 11:84286899-84286921 GTTAAGCGTACATGATCTGGAGG + Intronic
1086459247 11:86989426-86989448 AGGAAGTTTACATTATTTGGAGG - Intergenic
1086738541 11:90338212-90338234 CTTATGCCAACATGATTTGGTGG + Intergenic
1087224153 11:95579193-95579215 CTGAAGCTTCCATGATGGAGAGG - Intergenic
1087783295 11:102324933-102324955 CTGGAGTTTACAGGATTTGATGG - Exonic
1089383461 11:118052538-118052560 CTGAGGCTTACATAGTTTTGAGG - Intergenic
1091658354 12:2362422-2362444 CTGAATCCTACATGTTTTTGTGG + Intronic
1092045123 12:5426475-5426497 CTGCAGCTTTCTTCATTTGGAGG - Intergenic
1092428360 12:8390903-8390925 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1092429442 12:8397054-8397076 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1093423578 12:19001953-19001975 CAGAATTTTAGATGATTTGGGGG - Intergenic
1093780031 12:23124114-23124136 TTGAAGCTTATGTCATTTGGAGG + Intergenic
1093880840 12:24402574-24402596 CTAAAGCTTATACAATTTGGGGG + Intergenic
1094355172 12:29570101-29570123 CTGAAACTTACATGGTTGGTAGG - Intronic
1095602612 12:44030741-44030763 CTGAAGGTTACAAATTTTGGGGG - Intronic
1095912386 12:47441807-47441829 CTGAAGCTTATACAATCTGGGGG + Intergenic
1097596145 12:61633857-61633879 CTGGTACTTACATGAATTGGGGG - Intergenic
1099203046 12:79697482-79697504 CTGAAGCTTACATAATTTGGTGG + Intergenic
1099396343 12:82145693-82145715 CTGAATCTTAAATAGTTTGGGGG + Intergenic
1099742886 12:86663907-86663929 CTGAAGTTCAAATTATTTGGAGG + Intronic
1100567752 12:95814231-95814253 TTCAAGCTTATTTGATTTGGAGG + Intronic
1100736760 12:97543550-97543572 CTGAAGCTGGCATAATATGGAGG + Intergenic
1102957565 12:117069191-117069213 CTGAAGCATATACGATTTGGGGG + Intronic
1103021912 12:117541068-117541090 ATGAAGATTAAATGATGTGGAGG + Intronic
1106757364 13:32836477-32836499 CTGAAGCAAATATAATTTGGGGG + Intergenic
1107803678 13:44134094-44134116 CTGAAACTTATATAATATGGGGG - Intergenic
1110006395 13:70276394-70276416 CTGAGGTTTACATGATTTACTGG - Intergenic
1112838049 13:103540599-103540621 CTGAAGTTTCCATGACTTTGAGG + Intergenic
1113406312 13:110043995-110044017 CTGTAGCTAGCATGATTTGCAGG - Intergenic
1114849233 14:26362987-26363009 CTGAAGCATACATTATTTCTTGG - Intergenic
1116923674 14:50610022-50610044 CTGAAGCTTACATAATCTGTGGG - Intronic
1117899734 14:60519209-60519231 TTGAAGCTTACACTATTTGGAGG + Intergenic
1119604262 14:76001200-76001222 CTGAAGCTTATGCAATTTGGCGG + Intronic
1120082750 14:80234224-80234246 CTGAAGCTTCTATAATTTGGGGG + Intronic
1121461908 14:94086538-94086560 CTGAAGCTTACATAATTGGTGGG + Intronic
1121803637 14:96795974-96795996 CTGAAGCTCACATAATTTTGGGG + Intergenic
1123136006 14:106027719-106027741 CTGAAGGTCACCTGATTTGCAGG + Intergenic
1125846478 15:42859422-42859444 CTGAAGCTTAATGGATCTGGCGG + Intronic
1129445243 15:75612477-75612499 CTGAAGATTACATATTTTGGGGG - Intronic
1129584815 15:76851369-76851391 CTGATGATTACATGTCTTGGGGG - Intronic
1132207926 15:99999199-99999221 CTGAAGCTTACATTCTGAGGGGG + Intronic
1133369855 16:5239450-5239472 CTGTGTCTTGCATGATTTGGAGG - Intergenic
1133603861 16:7366904-7366926 CTCAAAATTAAATGATTTGGGGG - Intronic
1134277106 16:12786347-12786369 CTGCAACTTACATGGGTTGGAGG + Intronic
1134558026 16:15183102-15183124 CTGAAGCTCTCAGGATATGGAGG + Intergenic
1134918562 16:18094704-18094726 CTGAAGCTCTCAGGATATGGAGG + Intergenic
1136913320 16:34161222-34161244 CTGAAACTTAAAGGAATTGGTGG + Intergenic
1137970617 16:52981196-52981218 CTGAAGCTGAAACAATTTGGGGG - Intergenic
1138929999 16:61641809-61641831 CAGAAATTTACATGATTAGGAGG + Intergenic
1140432662 16:74917867-74917889 CTGAATCTTACACTTTTTGGTGG + Intronic
1140667895 16:77244460-77244482 CTTAAGCATAATTGATTTGGGGG + Intergenic
1140882685 16:79213221-79213243 CTGAAGCTGCCATGATCAGGAGG - Intergenic
1143523751 17:7461161-7461183 CTGGAGCTCACTGGATTTGGGGG + Exonic
1145954159 17:28842946-28842968 CTGAGGCTTAGAGAATTTGGCGG + Intronic
1150376848 17:64688555-64688577 CTCAAGTTTACCTGATTTTGAGG - Intergenic
1150836832 17:68571779-68571801 CTGAAGCTAATACAATTTGGAGG + Intronic
1152057340 17:78040243-78040265 CTGAACCTGACATGATCAGGTGG - Intronic
1153774129 18:8437854-8437876 CTGAAGCTTACACAATGTGGAGG + Intergenic
1155797684 18:30060313-30060335 CTGAAGCTCTGTTGATTTGGTGG - Intergenic
1156620242 18:38843023-38843045 CTCAAGCTTATGAGATTTGGAGG + Intergenic
1156817305 18:41326798-41326820 TTTAAGCCCACATGATTTGGAGG + Intergenic
1157966585 18:52215636-52215658 CTGAAGCTTATATGATTACAGGG + Intergenic
1159131305 18:64282644-64282666 CTGAAGCTTACTTGATGTCATGG + Intergenic
1164602850 19:29575261-29575283 TTGAAGCTTACATTTTTTGGGGG - Intergenic
1164740215 19:30570250-30570272 CTGAAGGTGACAGGATGTGGAGG - Intronic
1166713681 19:44953048-44953070 CTGAAGCTTATGTGTTTTGTGGG - Intronic
1166724677 19:45019510-45019532 CTGTATATTACATGATTTGATGG - Intronic
1167254037 19:48416475-48416497 CTGAAGCTTGCACAATTTGGAGG - Intronic
925217528 2:2110414-2110436 CAGAAGCTAACATGGGTTGGAGG - Intronic
925404034 2:3594488-3594510 CCGAATCTTGCATGTTTTGGGGG - Intergenic
925876761 2:8317880-8317902 CTGAACCTTACAGAATCTGGAGG - Intergenic
926496319 2:13592750-13592772 CTCAAGCTAACATGTTCTGGTGG + Intergenic
926976945 2:18524936-18524958 CTGAATCAGACAGGATTTGGGGG + Intergenic
927393213 2:22619625-22619647 CTGAGGCTTACAAGTTGTGGTGG - Intergenic
928917512 2:36488885-36488907 GTGAAAGTTACATGATTTGCAGG - Intronic
928930316 2:36617455-36617477 CTGAAGCTTATGTAATTTGGTGG - Intronic
928948884 2:36797173-36797195 CTGAAGCTTATACAGTTTGGGGG + Intronic
931579645 2:63759269-63759291 CTGAAGCTCATATAATTTAGGGG - Intronic
935105715 2:100041526-100041548 GTGAAATTTATATGATTTGGGGG - Intronic
937539175 2:122927204-122927226 GGGAAGCTAACATGATTTAGAGG - Intergenic
938114094 2:128591627-128591649 CTGAAGCCTATCTGATTTGCAGG - Intergenic
938830880 2:135049295-135049317 CAGAAGATTACATTTTTTGGGGG - Intergenic
939054267 2:137344375-137344397 CTGATGCTTCCATGATTGGGTGG - Intronic
939484295 2:142790629-142790651 ATGAAGCATACTTGATGTGGTGG - Intergenic
939731557 2:145790984-145791006 CTGAAGATTATATTATTTGGAGG - Intergenic
941145199 2:161835452-161835474 CTGAAGCTTACATAATCTACTGG - Intronic
941708525 2:168686561-168686583 CTGTAGATTACAGGATTTGGAGG + Intronic
943673110 2:190686282-190686304 CTGGAGCTTACATGTAGTGGAGG + Intronic
944364066 2:198895732-198895754 ATGAAGTCTACTTGATTTGGTGG - Intergenic
945856504 2:215075087-215075109 CTGAAGCTCCCATGCATTGGTGG - Intronic
945991756 2:216401790-216401812 CTGAAGCTCATACAATTTGGGGG + Intergenic
946604796 2:221391797-221391819 TAGAAGCTTATATGATTTTGAGG - Intergenic
948213225 2:236210263-236210285 CCGATGCCTACATGACTTGGGGG + Intronic
1169031752 20:2414917-2414939 CTGATGGTTACAGAATTTGGGGG + Intronic
1171079201 20:22160939-22160961 CTAAATCTTACATGATTTGGAGG + Intergenic
1171110595 20:22477841-22477863 ATGAAGCCCACATGATCTGGTGG - Intergenic
1171254940 20:23683633-23683655 CTGAGGCTTACATAATTCAGAGG - Intergenic
1171262281 20:23745559-23745581 CTGAGGCTTACATAATTCAGAGG - Intergenic
1171767650 20:29298950-29298972 CTGAAACTTAAAGGAATTGGTGG - Intergenic
1173584377 20:44171147-44171169 CTGAAGCTGAGATGATGTGTGGG + Intronic
1174011711 20:47455052-47455074 CTGAAGCTTAGACAATTTGGGGG - Intergenic
1174741409 20:53018097-53018119 CTGATGTATACATGATTTTGGGG - Intronic
1177256996 21:18677460-18677482 CTGAAGCTTACATAGTTTTTTGG + Intergenic
1180342754 22:11630736-11630758 CTGAAACTTAAAGGAATTGGTGG + Intergenic
1182742451 22:32577990-32578012 ATGCAGCTTACATGCTATGGAGG - Intronic
1183030330 22:35099049-35099071 CTGAAGCTTGCATGCTATAGGGG - Intergenic
1183684398 22:39353230-39353252 CTGAAGCTTACATGATTTGGGGG - Intronic
952455492 3:33467933-33467955 CTGTAGCCTACATGAACTGGGGG - Intergenic
953105094 3:39870032-39870054 CTGAAGCACACAGTATTTGGAGG + Intronic
953196557 3:40739546-40739568 CTGAAGCTTTAAGGATTGGGTGG - Intergenic
955220027 3:57015767-57015789 CTGAAACTTATATAATTTGGGGG - Intronic
956275416 3:67495157-67495179 CCTATGCTTACATGATTTAGAGG - Intronic
957532668 3:81460555-81460577 CTGAAGATTACCTGATTTTCAGG - Intergenic
959266901 3:104152734-104152756 GTGAAGCTTACATTATTTATAGG + Intergenic
960147388 3:114217903-114217925 CTGTCGCATTCATGATTTGGAGG - Intergenic
960188281 3:114671389-114671411 CAGAAGCTTAAACTATTTGGGGG - Intronic
961281020 3:125766163-125766185 CTGCGTCTTCCATGATTTGGAGG - Intergenic
961873372 3:130003422-130003444 CTGTGTCTTCCATGATTTGGAGG + Intergenic
962314871 3:134353094-134353116 CTGAAGCCTGTATAATTTGGAGG - Intergenic
963758675 3:149262530-149262552 CTGAATCTTAAAGGATTTGTTGG - Intergenic
967400728 3:189057234-189057256 CTGAAGCATACATCATGTGCTGG - Intronic
967910050 3:194535197-194535219 CTGAAGATTATATAATTTGGAGG - Intergenic
969016666 4:4107911-4107933 CTGTGTCTTGCATGATTTGGAGG + Intergenic
969684136 4:8660142-8660164 CTCAAGTTTACATGACTTGGAGG - Intergenic
969737291 4:9000404-9000426 CTGTGTCTTGCATGATTTGGAGG - Intergenic
969796494 4:9531992-9532014 CTGTGTCTTGCATGATTTGGAGG - Intergenic
970897027 4:21116198-21116220 CTGAAGCTTAAACAGTTTGGAGG - Intronic
971385440 4:26137254-26137276 CTGCAGCTCACAGGATTTGGGGG + Intergenic
972135476 4:35887753-35887775 GTAAAGCTAACAAGATTTGGTGG - Intergenic
973265890 4:48210002-48210024 CTGAAGCTTAAACACTTTGGAGG + Intronic
974516572 4:62921989-62922011 ATGTATCTTACATTATTTGGTGG - Intergenic
975611789 4:76211152-76211174 CTGAAGCTTATACAATTTGAAGG + Intronic
977963869 4:103119746-103119768 CTGAATCTGACCTGTTTTGGGGG - Intronic
978202814 4:106042902-106042924 CTGTAGCTTCCCTAATTTGGCGG + Exonic
983241160 4:165234796-165234818 CTTACACTTTCATGATTTGGAGG + Intronic
985354895 4:189108309-189108331 CTGAATCTTCCATGATTCTGGGG + Intergenic
986065710 5:4231715-4231737 CTGAAACTCCCTTGATTTGGAGG + Intergenic
986724576 5:10584739-10584761 GTGGAGCTTACGTGATTTTGGGG + Intronic
986983858 5:13478579-13478601 GGGAATCTCACATGATTTGGAGG + Intergenic
988697936 5:33642831-33642853 CTAGAGCTTACATGTTTTGTGGG - Intronic
989264162 5:39453746-39453768 CTGAAGATGACATATTTTGGGGG + Intronic
989528039 5:42475617-42475639 CTGAAACTTATACAATTTGGTGG - Intronic
989751077 5:44894769-44894791 CTGAAGCTGAAATGTGTTGGGGG - Intergenic
994213846 5:97114780-97114802 CTGAGGCTTACACAATTTGGGGG + Intronic
996173657 5:120328390-120328412 CAGAAGCTTATACAATTTGGAGG + Intergenic
997752948 5:136366490-136366512 CTGAAGATAACATGATATGTGGG + Intronic
1001244657 5:170096937-170096959 GAGAAGCTTAAATGCTTTGGTGG + Intergenic
1002839873 6:896402-896424 CTGAAGCTCACATGCAGTGGAGG - Intergenic
1006728608 6:36218223-36218245 CTGATGCTTACAGGGTTTGTGGG + Intronic
1010709382 6:79154688-79154710 TTGAAGTTTATATGATTTGGGGG - Intergenic
1012476311 6:99618306-99618328 CTGAAGCTGATGTGAGTTGGGGG - Intergenic
1014535973 6:122613514-122613536 CTGAAACTAACAGGATTTAGAGG - Intronic
1016868324 6:148791443-148791465 CTGGAGTTTACATGTATTGGTGG + Intronic
1017688746 6:156942201-156942223 CTGAAGCATAACTGATTTGCAGG + Intronic
1018032545 6:159853446-159853468 CTGAATGTTCTATGATTTGGTGG - Intergenic
1021956875 7:25834049-25834071 CTGAAGCTTATACAATTTTGGGG - Intergenic
1021960933 7:25872311-25872333 CTGAATCGTATATAATTTGGGGG + Intergenic
1023091333 7:36620197-36620219 GTTAAGCTTACAAGATTTGAGGG - Intronic
1023229644 7:38013197-38013219 ATGAAGCACAGATGATTTGGGGG - Intronic
1023344048 7:39252957-39252979 CTGGAGCTTACATTCTTTGGGGG - Intronic
1025074178 7:55928134-55928156 CTGAAGCTTACAAGAGTCAGTGG + Intronic
1027980668 7:85216881-85216903 CTGAAGCTTATATAATTTGGGGG - Intergenic
1028014903 7:85696395-85696417 CTGGAGCTTACATAATTTGTGGG - Intergenic
1029075141 7:97928711-97928733 CTGTGTCTTGCATGATTTGGAGG + Intergenic
1030903388 7:115151643-115151665 CTGAGGCTTAGACAATTTGGAGG - Intergenic
1031541829 7:123004536-123004558 CTGAATCTTAGATGCTTTGTTGG - Intergenic
1032896670 7:136258631-136258653 CTGAGGCTGTTATGATTTGGGGG + Intergenic
1036242389 8:7091667-7091689 CTGTTTCTTCCATGATTTGGAGG - Intergenic
1036258401 8:7222345-7222367 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036259461 8:7228489-7228511 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036311503 8:7687059-7687081 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036358007 8:8059022-8059044 CTGTGTCTTCCATGATTTGGAGG - Intergenic
1036359080 8:8065164-8065186 GTGTATCTTCCATGATTTGGAGG - Intergenic
1036830346 8:12015463-12015485 CTGTGTCTTCCATGATTTGGAGG + Exonic
1036892942 8:12607924-12607946 CTGTGTCTTCCATGATTTGGAGG + Intergenic
1036899426 8:12659763-12659785 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1036900494 8:12665910-12665932 CTGTTTCTTCCATGATTTGGAGG + Intergenic
1039737321 8:40346739-40346761 CTGTAGGTTACTTGTTTTGGGGG - Intergenic
1041152988 8:54955614-54955636 TTGAAGCTTTCAGCATTTGGGGG - Intergenic
1043570539 8:81597948-81597970 CTGAAGCTTGTATGCTTTGCTGG - Intergenic
1045999198 8:108398943-108398965 TTGAAGCTTATACAATTTGGTGG - Intronic
1046324132 8:112618556-112618578 TTAAAGCTCAAATGATTTGGGGG - Intronic
1046374150 8:113353758-113353780 GCTAACCTTACATGATTTGGGGG - Intronic
1047134494 8:122060702-122060724 CTGAAAATTACAGGATTTAGAGG + Intergenic
1048195002 8:132325211-132325233 CTGCAGCTCTCATGATTAGGTGG - Intronic
1050074416 9:1848422-1848444 CTGAAGCTAACATAAGGTGGGGG + Intergenic
1051888573 9:21920463-21920485 CTGAAACTTACTTAGTTTGGAGG + Intronic
1055350227 9:75378946-75378968 CTTAAAGTTACATGATTTGAGGG - Intergenic
1055434344 9:76277273-76277295 CTGAAGCCTTCATTCTTTGGGGG - Intronic
1056841024 9:89997923-89997945 CTTAATCTTAGAGGATTTGGGGG + Intergenic
1058197487 9:101996449-101996471 CTGAAACTTAGCTTATTTGGTGG - Intergenic
1060040376 9:120295373-120295395 ATGAAGCCAACATGAGTTGGAGG + Intergenic
1060531504 9:124349755-124349777 CTGAACCTTACAATATTCGGGGG - Intronic
1061071797 9:128315480-128315502 CTGAAGCTTAGAGGATTCCGTGG - Intronic
1203361000 Un_KI270442v1:219110-219132 CTGAAACTTAAAGGAATTGGTGG - Intergenic
1186565700 X:10659975-10659997 CTGAATTTTACATGATTTTCTGG + Intronic
1186814010 X:13217543-13217565 TTGAAGCTTATATGATTTTGAGG + Intergenic
1187251958 X:17606701-17606723 CTGAAACTTACATGTTAAGGAGG - Intronic
1187285954 X:17903821-17903843 CTGAAGCTTATAGAATTTGGTGG + Intergenic
1188273169 X:28168066-28168088 ATGAATATTACATGATATGGTGG - Intergenic
1188312729 X:28637440-28637462 ATGAAGCTTACATTATTCTGGGG - Intronic
1188933533 X:36144898-36144920 CTGTAGCTTCCCTGGTTTGGGGG + Intronic
1190829367 X:54046249-54046271 CTGAAGCTTATATGGTTTGGGGG + Intronic
1192324438 X:70120471-70120493 CTTAAGCTTACATGAATCAGAGG - Intergenic
1194710586 X:97232063-97232085 CTGATGTTTACATGCTATGGGGG - Intronic
1196975848 X:121156721-121156743 CTGAGGCTTATGTTATTTGGGGG + Intergenic
1197873019 X:131077492-131077514 CTACAGCCTTCATGATTTGGAGG - Intronic
1199060232 X:143347343-143347365 TTGAAGCTAAAATGATTTTGTGG + Intergenic
1199528019 X:148813777-148813799 CAGAAGCTGAAATGAATTGGTGG - Intronic
1199973137 X:152875299-152875321 CTGAAGCTTAGAAGAATTGGTGG + Intergenic
1201077447 Y:10198429-10198451 CTGAAACTTAAAGGAATTGGTGG + Intergenic