ID: 1183684593

View in Genome Browser
Species Human (GRCh38)
Location 22:39354435-39354457
Sequence CCTTGGTGCCATGGATATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 117}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183684593_1183684606 10 Left 1183684593 22:39354435-39354457 CCTGGATATCCATGGCACCAAGG 0: 1
1: 0
2: 0
3: 23
4: 117
Right 1183684606 22:39354468-39354490 GGGGGGCAGCTTCATACCCCTGG 0: 1
1: 0
2: 1
3: 5
4: 141
1183684593_1183684602 -8 Left 1183684593 22:39354435-39354457 CCTGGATATCCATGGCACCAAGG 0: 1
1: 0
2: 0
3: 23
4: 117
Right 1183684602 22:39354450-39354472 CACCAAGGGGTGGCCTGAGGGGG 0: 1
1: 0
2: 3
3: 23
4: 246
1183684593_1183684601 -9 Left 1183684593 22:39354435-39354457 CCTGGATATCCATGGCACCAAGG 0: 1
1: 0
2: 0
3: 23
4: 117
Right 1183684601 22:39354449-39354471 GCACCAAGGGGTGGCCTGAGGGG 0: 1
1: 0
2: 1
3: 20
4: 234
1183684593_1183684603 -7 Left 1183684593 22:39354435-39354457 CCTGGATATCCATGGCACCAAGG 0: 1
1: 0
2: 0
3: 23
4: 117
Right 1183684603 22:39354451-39354473 ACCAAGGGGTGGCCTGAGGGGGG 0: 1
1: 0
2: 0
3: 34
4: 286
1183684593_1183684600 -10 Left 1183684593 22:39354435-39354457 CCTGGATATCCATGGCACCAAGG 0: 1
1: 0
2: 0
3: 23
4: 117
Right 1183684600 22:39354448-39354470 GGCACCAAGGGGTGGCCTGAGGG 0: 1
1: 0
2: 1
3: 19
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183684593 Original CRISPR CCTTGGTGCCATGGATATCC AGG (reversed) Intronic
900964471 1:5948212-5948234 CGGTGGTGCCCTGGAGATCCTGG - Exonic
902334903 1:15749206-15749228 CTTTGGTTCCATGGGGATCCAGG + Intergenic
905732079 1:40304345-40304367 CCTTGGGGCCCTGGAATTCCGGG + Exonic
909450623 1:75794287-75794309 TCATGGTTCCATGGATTTCCAGG + Intronic
909486550 1:76180478-76180500 ACTTGGGGACAGGGATATCCAGG - Intronic
919943323 1:202303285-202303307 GAATGGTGCCATGGACATCCAGG + Exonic
1062900611 10:1142450-1142472 CCTGGATGGCATGGATGTCCTGG + Intergenic
1069629896 10:69891227-69891249 CCTTAGTGCCCTGGAAATCTTGG + Intronic
1069793576 10:71038947-71038969 CCCTGGGGCCAGTGATATCCAGG - Intergenic
1069911322 10:71761607-71761629 CCATGGTGCCATGGAGCTGCAGG - Exonic
1069954018 10:72038786-72038808 CCATGGTGTCATGGTTATCACGG + Intergenic
1076014645 10:127018027-127018049 CCTAGATGCCAGGGGTATCCTGG - Intronic
1077082450 11:730151-730173 CCTTTGTCACATGGATATCCTGG - Intergenic
1077515610 11:3000266-3000288 CATTGGTGCTGTGGACATCCAGG - Intergenic
1077581547 11:3420545-3420567 CCTTGGTGCCATGGCTGCCCTGG - Intergenic
1078667306 11:13336705-13336727 GGTTGATGCCATGGATAGCCAGG + Intronic
1079585824 11:22126222-22126244 TCTTGGTGCCATGCCAATCCTGG - Intergenic
1079926338 11:26496345-26496367 CCTAGGTGCCAGGGATACACTGG - Intronic
1081458269 11:43246848-43246870 CCTTGGTGCTATCGATAGTCGGG - Intergenic
1084238460 11:67803363-67803385 CCTTGGTGCCATGGCTGCCCTGG - Intergenic
1084833951 11:71789470-71789492 CTTTGGTGCCATGGCTGCCCTGG + Intronic
1089161569 11:116441818-116441840 CCTTGGTACCAAGGGCATCCTGG - Intergenic
1089821863 11:121235851-121235873 CCTTGGGGACATACATATCCAGG + Intergenic
1090240652 11:125179196-125179218 TCTTGGTGCCAGGGATATATAGG + Intronic
1092127344 12:6084306-6084328 CCTTGGAGCCAGGGAGATGCTGG - Intronic
1092409150 12:8240988-8241010 CCTTGGTGCCATGGCTGCCCTGG - Intergenic
1092441754 12:8510724-8510746 CCTTGGCTCCATGGCAATCCTGG + Intronic
1093353540 12:18134068-18134090 CCATGGTGCCATGGAGTTTCTGG - Intronic
1094832270 12:34305797-34305819 GCATGGTGCCTTGGAGATCCTGG + Intergenic
1097639850 12:62167496-62167518 TATTGGTGTCATTGATATCCAGG + Intronic
1098145235 12:67490505-67490527 CCTTGGTCCCATGGATTCTCTGG - Intergenic
1101040103 12:100746969-100746991 CCTTGGTGCCGTGGACATTTTGG + Intronic
1102937093 12:116906712-116906734 GCATGGTGGCATGGAAATCCTGG + Intergenic
1104038383 12:125114183-125114205 CCGTGGTGCCCTTGATGTCCTGG + Intronic
1104429474 12:128705140-128705162 CCTTGGTGTCGTAGATGTCCAGG - Exonic
1104717728 12:131027136-131027158 CCTTGGTGCACTGTAGATCCAGG + Intronic
1106146080 13:27050929-27050951 ACTTGGGGCCATGGATATTGAGG + Intergenic
1111503635 13:89158368-89158390 CCTTGGATCCCTGGTTATCCAGG + Intergenic
1116076547 14:40118351-40118373 CCTTTTTGCAATGAATATCCTGG + Intergenic
1117453846 14:55878271-55878293 CCACCGTGTCATGGATATCCTGG + Intergenic
1119161944 14:72459946-72459968 TCTTGGGGCCATGGAGAACCAGG + Intronic
1126134203 15:45375400-45375422 ACTTGTTGCCAGGGAAATCCTGG + Intronic
1126392020 15:48168387-48168409 TCTTGGTGGCATGCATATGCTGG + Intronic
1129426914 15:75470083-75470105 CCTTGGTGGTAGGGATAACCAGG - Intronic
1130764658 15:86857749-86857771 CCTGGGGGCCAGGGATGTCCTGG - Intronic
1132318104 15:100905000-100905022 CCTGGGTGCCATGTATCACCTGG - Intronic
1133350116 16:5095797-5095819 CCTTGGTGCCATGGCTGCCCTGG - Intronic
1135783102 16:25323549-25323571 CCTTGATGCTATGGACATTCGGG - Intergenic
1141240596 16:82261878-82261900 TCTAGGTGTCAAGGATATCCAGG + Intergenic
1145103634 17:20097042-20097064 CCTGGGTTGCATGGACATCCCGG + Intronic
1147673492 17:42190109-42190131 CCAGGGTGCCATGGAGATCAGGG - Intronic
1160402329 18:78620133-78620155 CCCTGGGGCCATGGAAGTCCAGG + Intergenic
1160834675 19:1119139-1119161 CGTTGGCGCCATGGAGATCGTGG - Exonic
1161852216 19:6743562-6743584 CCTTGGTGGCGTTGATATCCTGG - Exonic
1163962750 19:20712597-20712619 ACTTTGTGCCATTGTTATCCTGG + Intronic
1165339176 19:35198379-35198401 CCTTGGTGGTGTGGGTATCCTGG - Intergenic
1166381357 19:42356882-42356904 CCGTGGTGCCATGTATCTGCTGG + Exonic
926286347 2:11492041-11492063 CCTTGGTGCTATTGATTTCACGG + Intergenic
927847839 2:26480470-26480492 CCCTGCTTCCATGGATATCCAGG - Intronic
929845387 2:45520513-45520535 CACTAGGGCCATGGATATCCAGG - Intronic
933704554 2:85280059-85280081 CCTTGGTGCTGGGGATATCAAGG - Intronic
933744646 2:85561650-85561672 CCTTAGTGCCGTTGATCTCCAGG + Intronic
936894284 2:117408939-117408961 CCTTAGAGCCATTGATACCCAGG - Intergenic
937090511 2:119203139-119203161 CCTTGGGGCCATGGCTGTCAGGG - Intergenic
939193532 2:138944586-138944608 CCTTGGTGCAGTGGATGTCATGG + Intergenic
944406779 2:199393418-199393440 TCTTGGTACCCTGGATATCCAGG + Intronic
945357396 2:208856607-208856629 CCTTGGTACCGTGGATCCCCAGG - Intergenic
947147345 2:227080495-227080517 CCTGGCTGCCCTGGAAATCCTGG + Exonic
947149438 2:227099661-227099683 CCTGGGTGCCCTCGATTTCCAGG + Exonic
948631224 2:239303893-239303915 CCTTGGTGCCAAGCATTCCCAGG - Intronic
1173014145 20:39209632-39209654 ACTTGATGCCAAGGATATCATGG - Intergenic
1173757040 20:45525686-45525708 CCATGGTACCACGCATATCCAGG - Intergenic
1174382541 20:50165822-50165844 CCTTGGCCCCATTGACATCCTGG - Intergenic
1174657911 20:52187065-52187087 CCTTTGTCCCATGGAGTTCCAGG - Exonic
1175305988 20:57975862-57975884 CCTTGGTGCTCTGGATGGCCTGG - Intergenic
1181372998 22:22432586-22432608 CCATGGGTCCAGGGATATCCAGG + Intergenic
1181510478 22:23386634-23386656 CCTTGGAGCCCTGGACACCCTGG + Intergenic
1183684593 22:39354435-39354457 CCTTGGTGCCATGGATATCCAGG - Intronic
950589698 3:13928084-13928106 CCTTGGAGCCATGAAGATGCAGG + Intergenic
953519451 3:43627400-43627422 CCTTGGTGCCAGGCCTAGCCTGG - Intronic
954610730 3:51943345-51943367 CTTTGGAGCCATGGCTGTCCTGG - Exonic
957054412 3:75433154-75433176 CCTTGTTGCCATGGCTGCCCTGG - Intergenic
960494453 3:118358362-118358384 CCTTGGTGCCATTGCTGTCCTGG - Intergenic
961888080 3:130109519-130109541 CCTTGGTGCCATGGCTGCCCTGG - Intronic
963531089 3:146474309-146474331 CCTTGGTGCCGTGGAAATCTTGG - Intronic
964706549 3:159624755-159624777 CCTTGGGGCCCTGGATCTCTGGG - Intronic
965136249 3:164773280-164773302 CTTTGGTGTCATGGAAATGCTGG + Intergenic
967837924 3:193980218-193980240 CCTTCCTGACATGGATATCATGG - Intergenic
968553450 4:1236004-1236026 CTTTCAGGCCATGGATATCCCGG + Intronic
968997221 4:3953464-3953486 CCTTGGTGCCATGGCTGCCCTGG - Intergenic
969756792 4:9155218-9155240 CCTTGGTGCCATGGCTGCCCTGG + Intergenic
969816761 4:9692787-9692809 CCTTGGTGCCATGGCTGCCCTGG + Intergenic
970720867 4:18987358-18987380 ACTTGGGGCCATGGGTCTCCAGG - Intergenic
977607061 4:98994594-98994616 CCTTGGTGCCCTGGATGCCCTGG + Intergenic
978006654 4:103625666-103625688 CCTTGGTGCCAGGAAGCTCCCGG + Intronic
980446986 4:132922422-132922444 TCTTGGTGCCAGGGATTTCAGGG + Intergenic
980652649 4:135739570-135739592 CCTATGTAGCATGGATATCCTGG - Intergenic
981639008 4:146913482-146913504 TCTTGGTGGCATGGAAATTCAGG + Intronic
985306693 4:188550320-188550342 CCTTGGTGGCATGTTTATGCTGG - Intergenic
985819118 5:2147943-2147965 GCTGGGTGCCCAGGATATCCAGG + Intergenic
987286540 5:16463611-16463633 CCTTGGTGCCATCCCTATCACGG - Exonic
989339139 5:40354538-40354560 CCTGGGTGCCATGGGCATCATGG + Intergenic
991122395 5:63031583-63031605 ACTTGGTGAGAGGGATATCCAGG + Intergenic
995763720 5:115592654-115592676 TCTTGGTGTCATGGTTATGCTGG - Intronic
997879723 5:137578874-137578896 TCTGGGTGTCATGGATATTCAGG - Intronic
998165889 5:139843398-139843420 CGTTTGTCCCATGGATATCCTGG + Exonic
1003338973 6:5201646-5201668 TCTTGGTGCCCTGGATCTTCAGG - Intronic
1005992949 6:30914615-30914637 CCATGGAGCCACGGATATCAGGG - Intronic
1009858041 6:69289587-69289609 CTTTGGTGCCATGGGCATGCAGG - Intronic
1015440383 6:133241090-133241112 CCTCGGGGCCCTGGATGTCCCGG - Intronic
1015943310 6:138474058-138474080 CTATGGTGCCATGGATCTCGGGG + Intronic
1017657665 6:156645571-156645593 CCTTGGTGCCACCAATAGCCTGG + Intergenic
1017697317 6:157029968-157029990 TCTAGGTGCCATGGATTTACAGG - Intronic
1017916908 6:158838131-158838153 CCTGGGTGGCAGGGAGATCCCGG + Intergenic
1019626264 7:2017467-2017489 CCTCGGTGCCCTGGATACACCGG + Intronic
1020882458 7:13779098-13779120 CCTTGGTGCCACCCACATCCAGG - Intergenic
1022801917 7:33784894-33784916 CTTTTGTGCCATGGATATCATGG - Intergenic
1033903487 7:146172387-146172409 CCTTGGTACTATTGATATGCTGG - Intronic
1036380024 8:8230538-8230560 CCTTGGTGCCATGGCTGCCCTGG + Intergenic
1036849535 8:12192124-12192146 CCTTGGTGCCATGGCTGCCCTGG - Intronic
1036870897 8:12434397-12434419 CCTTGGTGCCATGGCTGCCCTGG - Intronic
1047547962 8:125838592-125838614 CCTGGGGGCCATGGATCTCTGGG + Intergenic
1048013077 8:130474132-130474154 CCTTGGTCCCATGGATGGGCTGG + Intergenic
1048284620 8:133132200-133132222 CCTTAGTGCCATTGACATCGGGG + Intronic
1048988069 8:139746013-139746035 CCTTGGTGCCAGGGAGACCTGGG - Intronic
1052963366 9:34319499-34319521 CCTTGCTCCCATAGATGTCCTGG - Intronic
1056231165 9:84545969-84545991 CCCAGGTGCCAGGGAAATCCTGG - Intergenic
1057822406 9:98342637-98342659 CCATGGTGCCCTGGATGGCCAGG - Intronic
1058294078 9:103283816-103283838 TCTTGGTAACATGGATACCCTGG + Intergenic
1059391665 9:114003016-114003038 CATGGGTGCCCTGGATATGCGGG + Intronic
1060052883 9:120389813-120389835 GATTAGGGCCATGGATATCCAGG + Intronic
1061863513 9:133479554-133479576 CCCTGGTGCCAGGGAGAGCCAGG - Intergenic
1186836456 X:13443250-13443272 CCATGCTGCCATGGAGATCCTGG + Intergenic
1187392213 X:18893628-18893650 AATTGGTGCCATGGACACCCTGG - Exonic
1195537531 X:106025857-106025879 CGTTGTTGCCATGAATTTCCTGG + Intergenic
1196577532 X:117337225-117337247 CCTTGGTTCCTTGTATATCCTGG + Intergenic
1197333094 X:125179207-125179229 CCTTGGTGCCATTCACATTCCGG - Intergenic
1197647492 X:129033850-129033872 CCTGGCTGACATGGATATCTTGG - Intergenic
1199929468 X:152503907-152503929 CCTTGCTCCCATGGCTTTCCCGG + Intergenic
1200099082 X:153680387-153680409 CATTCTTGCCATGGATATGCCGG + Intronic
1200777608 Y:7183402-7183424 CCTTGGTGGTAGGGATATCCTGG - Intergenic