ID: 1183688155

View in Genome Browser
Species Human (GRCh38)
Location 22:39373954-39373976
Sequence AAGGAGCCACAGGCCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 261}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183688155_1183688160 5 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688160 22:39373982-39374004 TTGAGAGTCGGTCCAGTCCCAGG 0: 1
1: 0
2: 0
3: 3
4: 65
1183688155_1183688161 14 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688161 22:39373991-39374013 GGTCCAGTCCCAGGATATCTTGG 0: 1
1: 0
2: 1
3: 5
4: 101
1183688155_1183688163 21 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688163 22:39373998-39374020 TCCCAGGATATCTTGGTGTCAGG 0: 1
1: 0
2: 0
3: 11
4: 130
1183688155_1183688165 22 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688165 22:39373999-39374021 CCCAGGATATCTTGGTGTCAGGG 0: 1
1: 0
2: 0
3: 11
4: 133
1183688155_1183688167 28 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688167 22:39374005-39374027 ATATCTTGGTGTCAGGGCCCAGG 0: 1
1: 0
2: 0
3: 8
4: 148
1183688155_1183688158 -7 Left 1183688155 22:39373954-39373976 CCCAGGAGGGCCTGTGGCTCCTT 0: 1
1: 0
2: 3
3: 31
4: 261
Right 1183688158 22:39373970-39373992 GCTCCTTGTTCTTTGAGAGTCGG 0: 1
1: 0
2: 0
3: 11
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183688155 Original CRISPR AAGGAGCCACAGGCCCTCCT GGG (reversed) Intronic
900541341 1:3204534-3204556 ACGGAGCCACGGGCTCCCCTGGG - Intronic
900882833 1:5394208-5394230 AAGGAACCAGAGGCAGTCCTGGG + Intergenic
901509606 1:9710237-9710259 TAGGAGCCACAAGCCACCCTGGG + Intronic
901532388 1:9861727-9861749 AGGCAGCTAAAGGCCCTCCTAGG + Intronic
904298509 1:29539400-29539422 AAGGTACCACAGCCCCCCCTTGG + Intergenic
904630671 1:31839780-31839802 AAGAAGCCAGAGGCCAGCCTGGG - Intergenic
905326791 1:37158639-37158661 AGGGGACCACAGGCCCTGCTGGG + Intergenic
905463517 1:38136471-38136493 CAGGTGCCACAGGCACTCCTTGG + Intergenic
905804031 1:40862874-40862896 GGGGAGCAACAGGCTCTCCTGGG - Intergenic
906057240 1:42926919-42926941 AAGGAGCCCCAGGCCCGGCTCGG + Exonic
907668944 1:56457849-56457871 AAGGAGCCAAGGGGGCTCCTTGG - Intergenic
910851368 1:91652208-91652230 AAGCAGCCCCAGAGCCTCCTTGG - Intergenic
911089029 1:94002678-94002700 AAGGAGCCACGTGCACACCTAGG - Intronic
911440486 1:97920707-97920729 GCGGAGCCACAGGCCCGCGTGGG - Intronic
912496602 1:110095677-110095699 GAGGAGACCCAGGCCCTCCCCGG - Intergenic
916303843 1:163306515-163306537 CATGAGCCAGAGGCCTTCCTGGG - Intronic
918118019 1:181513755-181513777 AAGGACCCAGGGGCCCTTCTTGG - Intronic
918243811 1:182642124-182642146 ATGGGGCCACTGGCCTTCCTAGG - Intergenic
919738707 1:200969889-200969911 AATGCCCCACAGGCCTTCCTGGG - Intronic
919872699 1:201834993-201835015 AAGGATCCAGACGCACTCCTGGG + Intronic
920097348 1:203495104-203495126 AATGAGGCACAGCCCTTCCTAGG - Intronic
920569412 1:207005238-207005260 CAGGAGCCACAGGACCTGCATGG + Intergenic
920617437 1:207507359-207507381 CTGGAGCCCCAGGCCTTCCTTGG + Intronic
920620100 1:207537161-207537183 CTGGAGCCACAGGCCTTCCTTGG + Intronic
920621882 1:207555716-207555738 CTGGAGCCACAGGCCTTCCTTGG + Intronic
920623508 1:207572810-207572832 CTGGAGCCACAGGCCTTCCTTGG + Intronic
920636072 1:207705058-207705080 CTGGAGCCCCAGGCCTTCCTTGG + Intronic
921424599 1:214986720-214986742 AAGGAGCCTCAGGACCTTCAGGG + Intergenic
922124670 1:222711425-222711447 CAGGAGCTCCACGCCCTCCTTGG - Intronic
924546401 1:245031712-245031734 AAGGAGCCCAAAGCCTTCCTTGG - Intronic
1066401742 10:35083495-35083517 AAGGAACCAGAGCTCCTCCTTGG + Intronic
1067031082 10:42879173-42879195 AAGGGGCCACAGACCAGCCTGGG + Intergenic
1067175814 10:43944726-43944748 AAGCTGCCACAGACACTCCTGGG + Intergenic
1069566357 10:69465982-69466004 CAGGGGCCACAGGCTCCCCTAGG + Intronic
1069681486 10:70288731-70288753 AAGGAGCCCCACCACCTCCTTGG + Intergenic
1070023019 10:72605530-72605552 AAGAATCCACATGGCCTCCTGGG + Intronic
1070132170 10:73663680-73663702 AAGGAGCCCCAGGTCCTCACTGG + Intronic
1070147622 10:73786108-73786130 GAGGAGCGGCAGGCCCTGCTTGG + Intronic
1071492826 10:86147713-86147735 AGGGAGAGACAGGCCCTCCAGGG - Intronic
1071561222 10:86648402-86648424 AAGGAGGAACAGGCCATTCTGGG + Intergenic
1071609511 10:87020395-87020417 AAGGAGCCCCAGGTCCTCACTGG - Exonic
1071934386 10:90511317-90511339 AAGCAGCCTGAGGCCCTCCTCGG - Intergenic
1075511895 10:123079216-123079238 TAGTGGCCACAGGGCCTCCTGGG - Intergenic
1076116440 10:127905111-127905133 AGGGAGCCACCCGCCCTGCTGGG + Intergenic
1076347341 10:129788432-129788454 GAGGAGCCTCAGGTCCTCTTTGG + Intergenic
1076485203 10:130811247-130811269 AAGGAGCCCCCTGCTCTCCTTGG - Intergenic
1076809163 10:132877824-132877846 ACTGAGGCACAGGCCATCCTGGG + Intronic
1078050406 11:7960784-7960806 AAGGTGCAGCAGGCTCTCCTTGG + Exonic
1078063785 11:8064746-8064768 ACAGGGCCACAGGGCCTCCTGGG + Intronic
1078194536 11:9124647-9124669 AAGAAGCCACTGACTCTCCTGGG - Intronic
1080424537 11:32143961-32143983 CAGGTGCCACAGGACCTCCCAGG + Intergenic
1081763551 11:45593582-45593604 AATGAGACACAGTCCCTGCTAGG + Intergenic
1081976003 11:47235220-47235242 AAGGAACCACAAGCCCTCTGTGG - Intronic
1082003894 11:47409283-47409305 AGGGAGCCCCAGGCCTTCCCTGG + Intronic
1083804495 11:65066015-65066037 AAGGGGCCGCAGTCCCTCCCCGG - Intergenic
1084462163 11:69302171-69302193 AAGGGGCCACAGGCCCTCTGCGG - Intronic
1085479012 11:76806380-76806402 AAGGAGCCTCAGAATCTCCTAGG - Intergenic
1087078360 11:94146593-94146615 GAGGACCCACAGCCCTTCCTCGG + Intronic
1087595960 11:100255757-100255779 TAGGACCCCCAGGCCCACCTGGG + Exonic
1087910870 11:103752054-103752076 CAGGAGCCCCAGCCCTTCCTTGG + Intergenic
1088445951 11:109928675-109928697 AAGCAGCCTCAGGCCCTCACTGG + Intergenic
1090920920 11:131205194-131205216 CAGCAGCTACAGGCCGTCCTGGG + Intergenic
1091837793 12:3597925-3597947 GAGAAGCCACAGACCCACCTGGG + Intergenic
1092149247 12:6235946-6235968 GAGGAGGGACAGGCCCTGCTTGG - Intronic
1093406056 12:18806121-18806143 AGGGAGCCCCAGGCCTTGCTGGG + Intergenic
1095825178 12:46523604-46523626 TAGGCTCCACAGGCCCTCCTGGG - Intergenic
1095985702 12:47998038-47998060 TAGGACCCAAAGGACCTCCTGGG - Exonic
1097015009 12:55979697-55979719 AAGAAGACCCAGGCCTTCCTTGG - Intronic
1099042666 12:77675791-77675813 AAGAAGCCTGAGGCCCTCCCAGG - Intergenic
1100572881 12:95859265-95859287 AAGAAGGCACGGGCACTCCTAGG - Intronic
1100959547 12:99947031-99947053 AAAGAGCCACAGGTCCTCCTTGG - Intronic
1102128047 12:110501809-110501831 AAGGGGCCAGAGGCCATCCAAGG - Intronic
1102442326 12:112972758-112972780 AGAGAGCCAGAGGGCCTCCTTGG + Exonic
1103522799 12:121547615-121547637 AAGGAGACACAGGCTGTCCCAGG - Intronic
1103852800 12:123944122-123944144 GAGGAGCCACAGATCCTTCTTGG + Intronic
1104267284 12:127245258-127245280 CAGGAGCCACAGGCCCTCAATGG - Intergenic
1104921728 12:132294150-132294172 TGGGGGGCACAGGCCCTCCTGGG + Intronic
1106245644 13:27947600-27947622 AAGAAGTGACAGGCCCTCCCAGG - Intergenic
1106804235 13:33289792-33289814 TAGAAGCCACAAGCCCTCTTAGG + Intronic
1107011816 13:35677724-35677746 AAAGAGCCCCAGATCCTCCTGGG - Intergenic
1109429401 13:62212420-62212442 AGGGAGGCACGGGCGCTCCTGGG - Intergenic
1110513004 13:76375057-76375079 AAAGACCCACAGGCTCTCCTAGG + Intergenic
1110635824 13:77766209-77766231 AAAGGGCCACAGGCACACCTTGG - Intergenic
1112443557 13:99443679-99443701 AAGGAGGACCAGGCACTCCTAGG + Intergenic
1113358119 13:109602389-109602411 ATGGAGCGAAAGGCCCTCCTAGG - Intergenic
1113983473 13:114295508-114295530 AAGGAGCCACGGGCACATCTGGG - Intronic
1114645201 14:24252240-24252262 AAGGAGCCACAGACTGTCCAGGG + Intronic
1114727431 14:24953972-24953994 AAGGATCCTCAGCCCATCCTGGG - Intronic
1114966799 14:27971657-27971679 TAGGAGGCACAATCCCTCCTGGG + Intergenic
1118607141 14:67512799-67512821 AAGGAGCTCCAAGCCATCCTGGG + Intronic
1118761510 14:68882982-68883004 AAGGAGCGCCTGGCCATCCTGGG - Exonic
1121604017 14:95227199-95227221 AATGAAACACAGGCCCTCCACGG - Intronic
1122153616 14:99737739-99737761 GAGGAGCCCCAAGCCCTGCTGGG + Intronic
1123034124 14:105464966-105464988 AGGGAGCCCCACGTCCTCCTCGG + Intronic
1123415352 15:20091067-20091089 AAGGAGCCTCAGGTCTTTCTTGG + Intergenic
1123524693 15:21098181-21098203 AAGGAGCCTCAGGTCTTTCTTGG + Intergenic
1125687491 15:41572267-41572289 GAGCAGCCAGAGTCCCTCCTGGG + Intronic
1125769070 15:42153189-42153211 AAGGACACCCAAGCCCTCCTCGG - Intronic
1126663129 15:51051902-51051924 AAAGAGCCCAAGTCCCTCCTCGG + Intergenic
1127995497 15:64151424-64151446 CTGGAGCCACAGGCCGTCCTTGG + Intergenic
1128891677 15:71337392-71337414 AAGGAGCATCAAGCCCTCCAGGG - Intronic
1128934254 15:71731940-71731962 TAGGAGCCACCTGCCTTCCTTGG + Intronic
1129070051 15:72943296-72943318 AAGCACCCAGAGACCCTCCTGGG - Intergenic
1132079466 15:98852266-98852288 AAGGAGCCTCAGCCCCTCGGAGG - Intronic
1132647463 16:1005605-1005627 AAGGAGCGCCAAGTCCTCCTGGG - Intergenic
1132809787 16:1792059-1792081 CTGGAGCCACAGGCGCTGCTGGG - Exonic
1132976659 16:2714390-2714412 GAGGAGCCCCAGCCCCTCCCGGG - Intronic
1133102554 16:3488110-3488132 GAGGAGCCGCAGCCCCACCTGGG - Intergenic
1136244216 16:28964062-28964084 ACGGAGCCACAGGCCACCCAGGG - Exonic
1136516861 16:30773660-30773682 AAGGACCCACAGGCCCAGCCTGG - Intronic
1136592235 16:31224448-31224470 CAGCAGCCACAGGCCCTGCGAGG - Exonic
1136613224 16:31379869-31379891 GAGGAGCCACATGCAGTCCTTGG - Intronic
1136990881 16:35150824-35150846 AGGGAGCCACATGCCCTCAATGG - Intergenic
1137639176 16:50013481-50013503 AAGGAGGGACAGGCCCTCTCTGG + Intergenic
1139515786 16:67451616-67451638 AAGCAGACACAGGCCCTGATGGG + Intronic
1139612959 16:68072125-68072147 TGGCAGCCACAGGCACTCCTAGG - Intronic
1141581415 16:85002200-85002222 GAGGAGCCACAGGCATTCCTCGG - Intronic
1141628149 16:85272301-85272323 AAGGAGCCTCAGGCCCGCAGAGG + Intergenic
1141630977 16:85287819-85287841 AAGGAGCCGCAGGAGCTCCATGG + Intergenic
1141961212 16:87410704-87410726 AGGGAGGCACAGGCCCACCCGGG + Intronic
1142213794 16:88821216-88821238 AAGGAGCCCCAGTTCCTCCAGGG - Intronic
1142352787 16:89587485-89587507 AAGCAGCCCCAAGCCCGCCTTGG + Intronic
1146654662 17:34628180-34628202 AAACAGCCACAGGCTCTGCTGGG - Intronic
1148199216 17:45738146-45738168 AAGTAGCCTGAGGCCCTCGTCGG + Intergenic
1149866704 17:60155058-60155080 AAGCAGCCACTGGCCCTCCAGGG - Intronic
1150433907 17:65139497-65139519 AAGCAGCCACAGGCACCCCTGGG + Intronic
1151967846 17:77440942-77440964 CAGGAGCTACAGGCCCTATTTGG - Intronic
1152327130 17:79648012-79648034 TAGGAGACACAGAGCCTCCTGGG + Intergenic
1153508674 18:5829941-5829963 TTGGAGCCACAGCCTCTCCTGGG - Intergenic
1155341490 18:24818590-24818612 CAGAAGCCACGGGCCCTCCTGGG + Intergenic
1156475643 18:37403802-37403824 ACAGAGCCACTGGGCCTCCTGGG + Intronic
1157904824 18:51560489-51560511 ACGGAGGCACTGGCCCACCTAGG + Intergenic
1158252602 18:55506342-55506364 TAGCAGCCTCAGGTCCTCCTAGG - Intronic
1158429316 18:57370076-57370098 AAAGACCCACAGGCCCTCTCAGG - Intronic
1158478668 18:57802643-57802665 AAGGAGCCGCAAGCCCTACCTGG + Intronic
1160364808 18:78314667-78314689 AGGGAGCCACTGGCCCTGCCAGG + Intergenic
1160597598 18:79988122-79988144 ACGGAGCCGCGGCCCCTCCTCGG + Intronic
1161077031 19:2290830-2290852 GTGGAGCCGCAGGCCTTCCTGGG - Exonic
1161238329 19:3208669-3208691 GAGGAGCCACAAGGCCTCCCCGG - Exonic
1161320662 19:3639335-3639357 GAGGAGGAACAGGCCCTCCCAGG - Intronic
1161578001 19:5065326-5065348 AAGGGAACACAGGCCGTCCTGGG - Intronic
1161767065 19:6213852-6213874 AAGGCCCCACAAACCCTCCTAGG + Intronic
1161872173 19:6878536-6878558 AAGGAGCCACAGGCTCAGGTTGG - Intergenic
1162386392 19:10362606-10362628 AATGAGGTACAGGCCGTCCTCGG + Exonic
1162562011 19:11422430-11422452 AAGCCCCGACAGGCCCTCCTGGG - Intronic
1162725431 19:12687664-12687686 GAGGAGCCACAGGGCCTCCTGGG + Intergenic
1162866380 19:13551010-13551032 AGGCAGCCACAGCCCATCCTAGG - Intronic
1163559165 19:18008891-18008913 AAGGAGACACAGACACTCCGGGG - Intronic
1163589565 19:18184640-18184662 AAGAAGCCAAGAGCCCTCCTGGG - Intergenic
1164434634 19:28218891-28218913 TAAGAGCCACAGCCTCTCCTGGG - Intergenic
1164907542 19:31979580-31979602 ATGCAGCCACAGGCTCTCCTGGG - Intergenic
1165305288 19:34999809-34999831 ACGGAGGCACCGGACCTCCTGGG + Intronic
1167265510 19:48480993-48481015 ATCCAGCCAGAGGCCCTCCTGGG - Intronic
1167508457 19:49883319-49883341 GAGGAGAGACGGGCCCTCCTAGG - Intronic
1168383387 19:55943024-55943046 TAGAAGCCACATGCCATCCTTGG - Intergenic
925041769 2:736758-736780 AGGGAGCCTCAAGCTCTCCTGGG - Intergenic
925683527 2:6448174-6448196 CAGCAGCCTCAGTCCCTCCTGGG + Intergenic
926492191 2:13538096-13538118 AAGGGGCCACTGGCCATGCTTGG + Intergenic
926761368 2:16281617-16281639 AAGGAGCCACAGTCCCTTCCCGG - Intergenic
926894392 2:17668973-17668995 AAGGAGCCACATGCAAGCCTGGG + Intronic
927875150 2:26650276-26650298 AAGGAGCCACTGGTCTGCCTGGG - Intergenic
928114212 2:28535383-28535405 TAGGAGCCACAGGGCCTCTGGGG - Intronic
928370153 2:30734694-30734716 AAGCAGCCACAGCCCCTCAGCGG - Intronic
932592826 2:73077294-73077316 GATGAGCCAGAGGACCTCCTAGG - Intronic
934580535 2:95434342-95434364 AATGTGCCAGAAGCCCTCCTGGG + Intergenic
934598914 2:95642375-95642397 AATGTGCCAGAAGCCCTCCTGGG - Intergenic
936532261 2:113284369-113284391 AATGTGCCAGAAGCCCTCCTGGG - Intergenic
937200924 2:120204128-120204150 AAGGAGCCTCAGGCCACCCTGGG + Intergenic
937747317 2:125430078-125430100 AAGGTGACACAGGCGCTCCTGGG + Intergenic
938064983 2:128277053-128277075 AAGGAACCACAGGTCCTGCCCGG + Intronic
938388105 2:130882257-130882279 AGGAAGGAACAGGCCCTCCTGGG - Intronic
942186622 2:173430202-173430224 ATGGAGCCCCAGTCCCTTCTGGG - Intergenic
947587065 2:231362910-231362932 CAGAAGCCACAGTCCCTCCACGG + Intronic
947633802 2:231670140-231670162 GGGCAGCCCCAGGCCCTCCTAGG + Intergenic
948631705 2:239306899-239306921 CGGGAGGCTCAGGCCCTCCTTGG - Intronic
949036945 2:241820216-241820238 AAGGAGCCACAGGCCTCTCTGGG + Intergenic
1169060174 20:2655298-2655320 AAAGAGCCACAGTCACTCCCTGG - Intronic
1172061435 20:32189853-32189875 CAGGAGCCGCGGGCCCTCCTGGG + Intergenic
1173747385 20:45448292-45448314 AAGCAGCCACAGGCCCTGTCTGG - Intergenic
1175222742 20:57426716-57426738 CAGGAGGCACAGGTCCTGCTGGG - Intergenic
1175761162 20:61562906-61562928 AAGCAGCAACAGGACCCCCTGGG + Intronic
1176058521 20:63161473-63161495 GAGGAGGCAGAGGCCCTCCTGGG - Intergenic
1176304329 21:5115329-5115351 GAGGACCCACAGGGCCACCTGGG + Intergenic
1179162550 21:38910130-38910152 AAGGAAGCCCAGGCTCTCCTGGG - Intergenic
1179514707 21:41898688-41898710 AAGGAGCCCCAGGCTCTGCCTGG + Intronic
1179852728 21:44146701-44146723 GAGGACCCACAGGGCCACCTGGG - Intergenic
1180079026 21:45477910-45477932 AAGGACCCCCAGGGCCTCCGGGG + Exonic
1181421558 22:22802887-22802909 AAGGAGACACAGGCCGTGGTGGG - Intronic
1182544741 22:31068434-31068456 AAGGAGCCTCAGGTCTTTCTTGG - Intronic
1182867619 22:33617951-33617973 AATGTGCCACAGTCCCTCCAAGG + Intronic
1183393037 22:37556677-37556699 AAGCAGCCACTGGCATTCCTGGG + Intergenic
1183688155 22:39373954-39373976 AAGGAGCCACAGGCCCTCCTGGG - Intronic
1184206734 22:43009201-43009223 AAACAGCCAGAGGCCGTCCTGGG - Intronic
1184863427 22:47189706-47189728 AAAGAGACGCAGCCCCTCCTGGG + Intergenic
952731668 3:36643421-36643443 AAGGAGCCTGCGGCCCTCATCGG - Intergenic
953484846 3:43285952-43285974 CGGGAGACACAGGCCCTGCTAGG - Intergenic
953798456 3:46003096-46003118 CAGGAGCCAAAGTCCCTCTTTGG - Intergenic
957221570 3:77389401-77389423 AAGTAGCCACAAGCCCGCATGGG - Intronic
958471315 3:94524172-94524194 CAGGTGCCACAGGTACTCCTTGG - Intergenic
961336931 3:126186291-126186313 AAGGAGCAACTGGGCCTTCTTGG + Intronic
961487696 3:127228066-127228088 AAGGATGGACAGGCTCTCCTAGG + Intergenic
961737911 3:129013897-129013919 AAGAAGCCACGGCCCTTCCTTGG - Intronic
962279661 3:134040257-134040279 AAGGAGCTACTGTCCCTGCTGGG + Intronic
964746109 3:160014053-160014075 AAGGTGCCACATGCACTGCTTGG - Intergenic
968441167 4:625220-625242 AGGTGGCCCCAGGCCCTCCTGGG - Intergenic
969282327 4:6179139-6179161 AAGGACCCACAGGCACACCTAGG + Intronic
970175774 4:13338085-13338107 AGGTAGCTCCAGGCCCTCCTTGG - Intergenic
979082985 4:116366131-116366153 ACGAAGGCACAGGCCATCCTAGG - Intergenic
981688724 4:147482515-147482537 AATGAGCTACAGACCCACCTTGG + Intronic
983096524 4:163568800-163568822 TAGGAGCCTCTGGTCCTCCTTGG - Intronic
984462240 4:180052873-180052895 TAGGAGGAACAGGCCCTCCCTGG + Intergenic
985024821 4:185730616-185730638 AAGGATGCTCAGGCACTCCTTGG + Intronic
985758683 5:1733721-1733743 GGGGAGCCTCAGGCTCTCCTGGG + Intergenic
986106119 5:4661276-4661298 ACGGAGCTAGAAGCCCTCCTCGG + Intergenic
986206382 5:5628747-5628769 ATGGGGCCTCAGTCCCTCCTTGG - Intergenic
986576229 5:9215557-9215579 TAGTAGCCCCAGGCACTCCTTGG - Intronic
986714704 5:10514445-10514467 ATGGAGCCACAGGTCTTCCCCGG + Intronic
986715665 5:10521948-10521970 AGGGAGCCACAGGCCAGCCCTGG - Intronic
987290705 5:16505700-16505722 AAGGCGTCAGAGGCCCTCCCAGG + Intronic
989101387 5:37826498-37826520 CAGAAGCCACAGGCCCGTCTTGG + Intronic
990718808 5:58669530-58669552 AAGGAGCCACTGGCTGACCTTGG - Intronic
992940069 5:81751931-81751953 CAGGAGTCACCGGGCCTCCTCGG - Intergenic
995477632 5:112563814-112563836 GAGAAGCCACAGGCCCTCAATGG + Intergenic
996443212 5:123513500-123513522 AAGGAGCCACTGACCAGCCTGGG - Intronic
997439161 5:133897148-133897170 GAGGAGGCACAGGCCATCATGGG - Intergenic
999692586 5:154161426-154161448 AAGGAGGCACTGGCCATCCATGG - Intronic
1001429569 5:171648533-171648555 AAGGACCCAGAGGACCCCCTGGG + Intergenic
1001441991 5:171750389-171750411 AAGGTGGCACAGGCCCTGCTAGG - Intergenic
1002709272 5:181184434-181184456 AAAGAGCCACAGGCCGCGCTGGG - Intergenic
1002792828 6:448172-448194 GTGGAGCCACAGGACCTCCCGGG - Intergenic
1003474801 6:6471475-6471497 CAGGAGCCACAGGCCTTGTTGGG + Intergenic
1007340393 6:41187751-41187773 AAGGAGACTCAGGCTATCCTGGG + Intergenic
1007383897 6:41507674-41507696 AAGGAACCACAGGCTATCCCTGG + Intergenic
1008405929 6:51118392-51118414 CAGGAGCCAAGGGCCCTCCTGGG - Intergenic
1010094664 6:72027248-72027270 AATGAACCACAAGGCCTCCTGGG - Intronic
1010625859 6:78135605-78135627 TAGGAGGCACATGCCCTGCTTGG - Intergenic
1011592598 6:88984933-88984955 CAGGAGTCACAGACCCGCCTGGG + Intergenic
1012631042 6:101468149-101468171 AAGGACCCACAGAGCCTCTTAGG + Intronic
1015870607 6:137772734-137772756 AAGGAGCCACAGACCCGCATTGG + Intergenic
1016856262 6:148673427-148673449 TAAGAGCCAGAGGGCCTCCTTGG - Intergenic
1017510733 6:155112513-155112535 AAGGTGCCCCAGGGCCTCCTTGG + Intronic
1017957002 6:159187051-159187073 GAGGAGCCAGCGGCACTCCTGGG - Intronic
1019159216 6:170058055-170058077 CGGGCGCCACAGTCCCTCCTGGG + Intergenic
1019293452 7:261564-261586 AAGGGGCCACAGCACCTCCCTGG - Intergenic
1022190835 7:28015759-28015781 AAGGATCCACAGCCTCTGCTGGG - Intronic
1022693450 7:32681219-32681241 AAGAACCCACATGGCCTCCTGGG + Intergenic
1022921127 7:35015814-35015836 AAGAACCCACATGGCCTCCTGGG + Intronic
1025170211 7:56749638-56749660 ATTGAGCCCCAGGCCCTCCATGG - Intergenic
1025850335 7:65239127-65239149 AGGGTGCCCCAGGCCCGCCTTGG - Intergenic
1026881579 7:73909687-73909709 CTAGAGCCACAGGCCCTCCTAGG - Intergenic
1029594635 7:101530782-101530804 TGGGAGCCACTGGCTCTCCTGGG - Intronic
1030112874 7:106041445-106041467 GAGCAGCCACAGGGCATCCTGGG + Intergenic
1031703564 7:124956067-124956089 AAGAAGCCACATGGCCTCCAGGG - Intergenic
1034897351 7:154886061-154886083 CAGGTGCCACAGGCCCTGCCGGG + Intronic
1035325762 7:158064859-158064881 AAGGAGTGCCAGGGCCTCCTGGG + Intronic
1035360527 7:158310581-158310603 AAGGAGCCACTGGGCCTGCTCGG + Intronic
1035709908 8:1705284-1705306 AAGGGGCCAGGGGACCTCCTGGG + Exonic
1035967783 8:4213670-4213692 AAGCAGCCATGGGCCCTCCCTGG + Intronic
1036183416 8:6604201-6604223 AAGGAGCCACAGCCCCTCCATGG + Intronic
1037787683 8:21912289-21912311 CAGGAGGTACAGGCGCTCCTTGG + Exonic
1040840563 8:51780226-51780248 GCAGAGCCTCAGGCCCTCCTAGG + Intronic
1042489038 8:69378250-69378272 AGGGAGCTACAGGACCCCCTGGG - Intergenic
1043385937 8:79747910-79747932 AAAGGGCCAAAGGCCCTGCTTGG + Intergenic
1048737678 8:137519696-137519718 AAGGGGCCACAGGCACTCTTTGG + Intergenic
1049483662 8:142840159-142840181 AAGCAGCCCCAGGACCTCCCTGG + Intronic
1049997160 9:1044675-1044697 AACCAGCCACATGCCCTCCCAGG + Intergenic
1052620420 9:30901439-30901461 CAGGAGCCTCAGGCATTCCTTGG + Intergenic
1053549752 9:39064026-39064048 AAGGACCCATAGTCCCTCCCTGG + Intergenic
1053813864 9:41884119-41884141 AAGGACCCATAGTCCCTCCCTGG + Intergenic
1054616732 9:67303321-67303343 AAGGACCCATAGTCCCTCCCTGG - Intergenic
1055274350 9:74597383-74597405 CAGCAGCCACAGGGCCTCATGGG + Intronic
1055718130 9:79141287-79141309 AAGCAGCCCCAGGCCAACCTGGG - Intergenic
1057442309 9:95091293-95091315 AAGGGGCCACAGTCTGTCCTGGG + Intergenic
1057911884 9:99025929-99025951 ATGGAGCCACCGGCCTTCCCGGG + Exonic
1059445868 9:114337398-114337420 TAGGAGCCACTGGCCCAGCTGGG - Intronic
1060047523 9:120352312-120352334 AAGGAGCCACAGCTGTTCCTGGG - Intergenic
1060054321 9:120400754-120400776 AAGGGGGCACTGGCCATCCTCGG + Exonic
1060250188 9:121980162-121980184 AAGGCCCCCCTGGCCCTCCTAGG - Intronic
1060656345 9:125375000-125375022 CAGGAGCCCCCTGCCCTCCTGGG - Intergenic
1061941346 9:133885833-133885855 AAGGAACCACAGGCGCCACTGGG + Intronic
1062017982 9:134301330-134301352 ACTGAGCCACAGGTCATCCTTGG + Intergenic
1062517091 9:136942227-136942249 AAAGTGCCGCAAGCCCTCCTTGG + Exonic
1062668105 9:137689047-137689069 AAGCAGTCACAGTCACTCCTGGG - Intronic
1186542555 X:10415594-10415616 AAGGAGTCATAGGACCTGCTGGG + Intergenic
1187051222 X:15697472-15697494 GAGGAGCTCCAGGCCCTTCTGGG - Intronic
1191184191 X:57592410-57592432 CTGGAGCCCCGGGCCCTCCTCGG - Exonic
1193619905 X:83738692-83738714 AAGGACCCCCAGGCCCTGGTTGG - Intergenic
1194983103 X:100460569-100460591 AAGAAGCCACATACCTTCCTGGG - Intergenic
1195755488 X:108195088-108195110 AAGGAGTCCAAGGCCCTCCAGGG - Exonic
1197358909 X:125473286-125473308 AAGGAGCCAAGGACCCTGCTAGG - Intergenic
1198618205 X:138480936-138480958 GAGGAGTCGCAGGCCCTGCTAGG + Intergenic
1198618391 X:138481847-138481869 GAGGAGTCCCAGGCCCTGCTGGG + Intergenic
1200001932 X:153066600-153066622 GAGGAGCCCCAGGCTCTCCCTGG + Intergenic
1200005800 X:153083425-153083447 GAGGAGCCCCAGGCTCTCCCTGG - Intergenic
1200766181 Y:7082766-7082788 AAGACGCCATGGGCCCTCCTGGG - Intronic
1201306447 Y:12554778-12554800 AAGCAGCCACAGGCAGTCCATGG - Intergenic