ID: 1183689201

View in Genome Browser
Species Human (GRCh38)
Location 22:39378788-39378810
Sequence CCTGGGCTGCAGAGGGAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1115
Summary {0: 1, 1: 1, 2: 14, 3: 122, 4: 977}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183689201_1183689217 18 Left 1183689201 22:39378788-39378810 CCATCCTCCCTCTGCAGCCCAGG 0: 1
1: 1
2: 14
3: 122
4: 977
Right 1183689217 22:39378829-39378851 TCTCCTTTGCTCCTGTCTTGTGG No data
1183689201_1183689210 -7 Left 1183689201 22:39378788-39378810 CCATCCTCCCTCTGCAGCCCAGG 0: 1
1: 1
2: 14
3: 122
4: 977
Right 1183689210 22:39378804-39378826 GCCCAGGCCAGCGGGGGCCCAGG 0: 1
1: 1
2: 7
3: 66
4: 652

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183689201 Original CRISPR CCTGGGCTGCAGAGGGAGGA TGG (reversed) Intronic
900382343 1:2391233-2391255 CTTGGCCTGCTGCGGGAGGAGGG + Intronic
900394232 1:2446567-2446589 CATTGGAGGCAGAGGGAGGAAGG + Intronic
900396626 1:2455690-2455712 CCTTTGCTGCAGATGGAGGCGGG + Intronic
900512387 1:3066826-3066848 GCTGGGCTGCAGGGTGAGGGTGG + Intergenic
900626531 1:3611140-3611162 GCCGGGCTGCAGCGGGAGCAGGG + Exonic
900628752 1:3622700-3622722 TCAGGGCTGCAGAGGGAGCATGG + Intergenic
900672823 1:3866329-3866351 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
900822402 1:4899665-4899687 CCTGGGAGGCAGAGTGAGGAGGG - Intergenic
900829008 1:4950683-4950705 GAGGGGCTGCAGGGGGAGGATGG + Intergenic
901261782 1:7876426-7876448 CATGTGCTGCAGAGGGGGGAGGG + Intergenic
901269566 1:7941457-7941479 CATGGGTGACAGAGGGAGGAAGG + Intronic
901445801 1:9307399-9307421 CAGGGGCTGGGGAGGGAGGATGG - Intronic
901837728 1:11934946-11934968 CCTGGGCTGGAGAGGGAGTCTGG + Intronic
902251463 1:15156342-15156364 CCAGGCCTGCAGAGGGAGGGAGG - Intronic
902604026 1:17558861-17558883 CCTGGGCTGGGCAGGGAGAATGG + Intronic
902629703 1:17697299-17697321 TCTGGGCAGCAGTGGGAGGCAGG + Exonic
902658243 1:17884199-17884221 CAGGGGCTGCAGAGGTAGGCAGG + Intergenic
903346189 1:22685702-22685724 CGGGGGCTGCTGTGGGAGGATGG - Intergenic
903646109 1:24897358-24897380 CCGGGGCTGAGGAGGGAGGCAGG + Intergenic
903765475 1:25731634-25731656 CCTGTGTTAGAGAGGGAGGAAGG - Intronic
904003389 1:27350930-27350952 CCGGGGCTGCAGGGGGAGCCAGG - Exonic
904093333 1:27959990-27960012 CCGGGGTTGCCGAGGCAGGAAGG - Exonic
904377061 1:30088316-30088338 CCTGGCCTGCAGAAGGAGCAGGG - Intergenic
904418858 1:30378750-30378772 ACTGAGGTGCAGAGGGAGAAGGG + Intergenic
904570558 1:31461098-31461120 CCTGGGCTTGGGAGAGAGGAAGG + Intergenic
904611165 1:31727150-31727172 CCCGGGCTGGGGAGGGGGGAGGG - Exonic
904737463 1:32645644-32645666 CCTGGGCTACAGAGTAAGGCTGG - Intronic
904913222 1:33950838-33950860 CCTTGGCTGAATAGGAAGGAGGG - Intronic
905002038 1:34680117-34680139 CTAGGGCTGCACAGGGTGGAGGG + Intergenic
905267490 1:36764872-36764894 CCTTGGCTGAAGAGGGTGGGTGG - Intergenic
905419741 1:37832928-37832950 CCTGGGCGGCAGAGGTTGCAGGG + Intronic
905508127 1:38496327-38496349 CCTGGGCTGCGGAGGGAAGAAGG + Intergenic
905582786 1:39094863-39094885 CCTGGGCTACAGAGTGAGACCGG + Intronic
905651633 1:39660801-39660823 TTTGAGCTGCAGAGGGGGGATGG + Intronic
905876209 1:41433442-41433464 CCTGGGCTGCAGGGGGCAGGGGG - Intergenic
906098358 1:43239436-43239458 ACAGGGCTGTAGAGGGTGGAGGG + Intronic
906244244 1:44262061-44262083 GCTGGGCTGCGGTGGGTGGAGGG - Intronic
906990634 1:50733820-50733842 CCTGGGCAGCAGAGTGGGTATGG - Intronic
907317735 1:53583271-53583293 CCTGGGCTGCAGAGTTTTGATGG - Intronic
907411328 1:54285787-54285809 CCAGGGCTGCAGTGGGTGCATGG + Intronic
907508018 1:54935952-54935974 CCTGGGCAACAGAGGGAGACTGG + Intergenic
907523583 1:55040503-55040525 CATGGGCAGCGGAGGGTGGAGGG + Intronic
907741439 1:57170070-57170092 CCTGGGATGCAGAGGTTGCAGGG - Intronic
907757973 1:57329278-57329300 CATGGGCTTTGGAGGGAGGAAGG - Intronic
907933410 1:59020579-59020601 CCAGAGCTGTAGAGGGAGAAGGG - Intergenic
908010366 1:59770009-59770031 CGTGGGTTCCAGAGAGAGGATGG + Intergenic
908807461 1:67946046-67946068 GCTGGGCTGCAGAGAGAGTGAGG + Intergenic
909538083 1:76760625-76760647 CCTGGGGAGCAGAGGGAAGTGGG + Intergenic
909756062 1:79227467-79227489 CCTGGGTTGGAGAGGGGGCAGGG - Intergenic
910530198 1:88227136-88227158 CATGTGGTGCAGAGGTAGGAGGG + Intergenic
910806349 1:91192718-91192740 ACTGGGCTTCAGAGGGAGTGGGG + Intergenic
910846842 1:91612119-91612141 CTTGGGCTCCAGAGGGAGTCTGG - Intergenic
910891826 1:92026851-92026873 GCTGGGCATCAGAGGGGGGACGG + Intergenic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
915341154 1:155177463-155177485 CCTGGGCTGCAGGAGGGGGCAGG + Intronic
915358052 1:155268445-155268467 CCTGGGGTGGAGATGAAGGAAGG + Intronic
915734446 1:158075909-158075931 CATGGGTCTCAGAGGGAGGAAGG + Intronic
915839263 1:159201951-159201973 GCCTGGCTGCTGAGGGAGGAAGG - Exonic
915924399 1:160004974-160004996 CCTTGGCTGTGGAGGGGGGATGG - Intergenic
916563705 1:165955117-165955139 CCTGGGCTCCAGAAGTGGGAGGG - Intergenic
916717117 1:167455470-167455492 CCTTGGCTGCATGGTGAGGAAGG - Intronic
917207307 1:172590775-172590797 CTTGGGATGCAGATGGAGGTAGG - Intronic
917802993 1:178587238-178587260 CCAGAGCTGCAGAGAGAGGGGGG - Intergenic
918135062 1:181664731-181664753 CCTTGGCTGCAGAGGTATGGCGG + Intronic
918215451 1:182389710-182389732 CCTGGTCCACGGAGGGAGGAGGG - Intronic
919854211 1:201694542-201694564 CCCTGGCTGCAGAGGGAGGAGGG + Intronic
920086655 1:203422398-203422420 CCTGGGGTGAGGACGGAGGAGGG - Intergenic
920340599 1:205272964-205272986 CCCTGGCTTCAGAGAGAGGATGG - Exonic
920449398 1:206047806-206047828 CCTAGGATGCAGAAGGAGGGAGG - Intronic
920666267 1:207964718-207964740 CCTGTGCCCCCGAGGGAGGAGGG + Intergenic
921157384 1:212449188-212449210 CCTGGGATGAAGAAGGAGGGAGG + Intergenic
921184098 1:212655520-212655542 GATGGCCTGCAGAGGGAGGGAGG + Intergenic
921552327 1:216553184-216553206 CCTGGGCTGCAGAGGGAGAGAGG - Intronic
921581759 1:216903778-216903800 CCAGAGCTGCAGAGGGTGGTTGG - Intronic
922153200 1:223022357-223022379 CCTGGGCAGCAGAAGGAAGGTGG + Intergenic
922469787 1:225868946-225868968 TCTGTGCTACAGAGGGAGAAGGG + Intronic
922779865 1:228243349-228243371 CAAGGGCTGCAGACGGAGGCTGG + Exonic
922782526 1:228264282-228264304 CGTGGGCTGCACACGGAGGCTGG + Exonic
922783049 1:228268696-228268718 CGTGGGCTGCACACGGAGGCTGG + Exonic
922783548 1:228272112-228272134 CGTGGGCTGCACACGGAGGCTGG + Exonic
922895102 1:229093800-229093822 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
923035008 1:230279656-230279678 GCTGGGCTGCACCGAGAGGAGGG - Exonic
923389663 1:233501886-233501908 CCTGGGCAGCACAGGGAGACAGG - Intergenic
923846135 1:237734743-237734765 CCTGGGGTGAAGAGAGAAGAAGG + Intronic
924337608 1:242999266-242999288 CGTGGGATGGAGAGAGAGGAGGG - Intergenic
924370770 1:243347989-243348011 CCTGGGTTGGTGAGGGAGGAGGG - Intronic
924594083 1:245430149-245430171 TGGGGGCTGAAGAGGGAGGATGG + Intronic
924908737 1:248485796-248485818 TGTAGACTGCAGAGGGAGGATGG + Intergenic
924915371 1:248562266-248562288 TGTAGACTGCAGAGGGAGGATGG - Intergenic
924939742 1:248804735-248804757 CCTGGGCTGCAGAGGCAGGTGGG + Intergenic
924939746 1:248804752-248804774 GGTGGGCTGCAGAGGCAGGTGGG + Intergenic
1062997636 10:1881808-1881830 CCAGGGCTTCTGAGAGAGGACGG + Intergenic
1063570423 10:7210401-7210423 ACTGGGCAGCAGAGGCAGGAGGG + Intronic
1063607317 10:7534072-7534094 CCTGTGCTGTAGAGGGTGGGAGG - Intergenic
1063655281 10:7982422-7982444 CCTGGGCAACAGAGTGAGGGAGG - Intronic
1064265368 10:13821246-13821268 GCTGTGCTGGAGAGGCAGGAAGG - Intronic
1064269039 10:13848785-13848807 CCTTGGCTGAAGAAGGAAGATGG + Intronic
1064392974 10:14957486-14957508 CCGGGGCTACAGAGGAAGGAGGG + Intergenic
1064462677 10:15550436-15550458 CCTGCCCTTCAGAGGGAAGAGGG + Intronic
1064697407 10:17982104-17982126 ACTGGGCTGCTGTGGGATGAAGG + Intronic
1064745875 10:18477668-18477690 AGTGGGCTGCAGAGGGAAGATGG + Intronic
1065487057 10:26245781-26245803 CCTGGGCTGCTGAGAGAAGATGG - Intronic
1066372129 10:34826130-34826152 CCTGTGCTGCAGAGGCTGGAAGG + Intergenic
1066491518 10:35899328-35899350 CCGTGGCTGCAGATGGAGGATGG + Intergenic
1066602842 10:37126028-37126050 CCGGGGCTGCAGGAGGAGGTGGG + Intronic
1067140739 10:43654471-43654493 CCTGGGAGGCAGAGGTAGCAGGG - Intergenic
1067157534 10:43794580-43794602 CCAGGGCTGGAGAGTGAGGCCGG + Intergenic
1067337898 10:45379279-45379301 GAGGGGCTGGAGAGGGAGGAAGG - Intronic
1067552938 10:47247848-47247870 CCTGAGGGGCAGAGGGAGGCAGG + Intergenic
1067582542 10:47454583-47454605 CCTAGGCTGGGCAGGGAGGATGG + Intergenic
1067741382 10:48898254-48898276 CCTGAGCAGCAAAGGGAGTAGGG + Intronic
1068505372 10:57893555-57893577 CCTGGATTCCAAAGGGAGGAAGG + Intergenic
1069589687 10:69634141-69634163 TCTGGGCCACAGAGGGAGGAGGG + Intergenic
1069680853 10:70284095-70284117 CCAGGGCTGCAGTGGGAGGAGGG - Intergenic
1069736266 10:70656726-70656748 GCTGGGATGCAGAGAGCGGAAGG + Intergenic
1069784228 10:70977665-70977687 TCTGGGGTGCAGTGGGAGGTGGG + Intergenic
1069862812 10:71481956-71481978 CCTGGGCTGCAAAGGGTGGGGGG + Intronic
1069945438 10:71982285-71982307 GCTGGTTTGCAGATGGAGGAAGG + Intronic
1070310869 10:75272959-75272981 ACTGGGCATCAGAGTGAGGATGG + Intergenic
1070644956 10:78195386-78195408 CCTGGCCTTCAGAAGGTGGAAGG + Intergenic
1070831060 10:79418399-79418421 CCTGGCAGGCAGAGGGAGCATGG - Intronic
1070868667 10:79727981-79728003 TTTGGGGTGCAGAGGAAGGATGG + Intergenic
1070921071 10:80186708-80186730 CCTGGTCTGGAGAGGCAGGCAGG - Intronic
1070982413 10:80660213-80660235 CCAGGGCTGGAGAAGGAGGGTGG - Intergenic
1071486455 10:86105700-86105722 CCTTTGCTGGAGAGGGGGGATGG - Intronic
1072621769 10:97084353-97084375 CCTGGGCTGCAGAGCCACAAAGG + Intronic
1072687541 10:97547388-97547410 CTGGGGCAGAAGAGGGAGGATGG - Intronic
1072723963 10:97800243-97800265 CCTGGGCTTTAGAGGGAGAAAGG + Intergenic
1073110693 10:101061549-101061571 CCTGGGCTGCGGGGAGACGAAGG + Intergenic
1073141388 10:101250634-101250656 CCGGGGCTGAGGTGGGAGGAGGG - Intergenic
1073217391 10:101843908-101843930 CCCGGGCTGCAAAGGGTGGGGGG - Intronic
1073218007 10:101847358-101847380 CTTGGGCAGCAGGGGCAGGAGGG - Exonic
1073255202 10:102146650-102146672 CCTGTGGTGGGGAGGGAGGATGG - Exonic
1073541624 10:104319869-104319891 CCTGAATTCCAGAGGGAGGAGGG - Intronic
1073989886 10:109250823-109250845 ACTGGAGTGCAGAGGGTGGAAGG - Intergenic
1074124934 10:110521355-110521377 CTTGGGATGCGAAGGGAGGACGG - Intergenic
1074509759 10:114101382-114101404 CCCGGCCTGCAGAGTGGGGAGGG + Intergenic
1076276518 10:129204185-129204207 CGTGGGCTCCAGAGGCAGGGTGG - Intergenic
1076280464 10:129242259-129242281 GCTGGGGTGGAGAGGGAGAATGG + Intergenic
1076520154 10:131076293-131076315 ACTGGGGTGCAGAGGGATGGAGG - Intergenic
1076607644 10:131700010-131700032 TTTGAGCTGCAGAGGGAGCATGG - Intergenic
1076644660 10:131944666-131944688 ACTGGACAGCAGAGGGAGGACGG - Intronic
1076667676 10:132102402-132102424 CATGGGGTACAGAGGGAGGAAGG - Intergenic
1076903386 10:133350730-133350752 CCTGGGATGGATCGGGAGGAAGG + Intronic
1077036009 11:494830-494852 CCAGGGCTGCCCAGGGAGGAAGG - Intronic
1077140468 11:1022059-1022081 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140476 11:1022096-1022118 GCGGGGCTGCAGAGGGCAGAGGG - Intronic
1077140503 11:1022202-1022224 ACAGGGCTGCAGAGGGCAGAGGG - Intronic
1077140540 11:1022348-1022370 CGCGGGCTGCAGAGGGCAGAGGG - Intronic
1077169670 11:1160595-1160617 CATGGCCTGCAGAAAGAGGAGGG - Exonic
1077219963 11:1411462-1411484 CTTGGGGAGCAGAGGGAGGAAGG - Exonic
1077310939 11:1888904-1888926 CCTGGGCTGCAGTGGTGTGAGGG - Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077496657 11:2889991-2890013 CCTGGGGTGCTGTGGGAGGGTGG - Intronic
1077532498 11:3103787-3103809 AGAGGGCTGCAGAGGCAGGAAGG - Intronic
1077532529 11:3103907-3103929 GATGGGCTGCAGAGGCAGGAAGG - Intronic
1078320965 11:10334206-10334228 CCTGTGCTACAGAGGCTGGAAGG - Intronic
1078895283 11:15592020-15592042 GCTGGGCTTCACATGGAGGAAGG + Intergenic
1079101320 11:17544017-17544039 CCTGGAAGGCAGAGGGAGAAAGG + Intronic
1079328428 11:19513936-19513958 CCTGAGCTCCAGAGGGAGCATGG + Intronic
1079335298 11:19565387-19565409 TCTTGGATGAAGAGGGAGGAGGG - Intronic
1080889667 11:36398455-36398477 CCAGAGCAGCACAGGGAGGAAGG - Intronic
1081501185 11:43668289-43668311 GCTGGTCTGAAGATGGAGGACGG - Intronic
1081527165 11:43935035-43935057 CCGGGGCTGCAGGGGAAGGCTGG - Intronic
1081651778 11:44828705-44828727 GCTGGGCTACAGAAGGGGGAAGG - Intronic
1081690416 11:45074177-45074199 CCTGGGCTGCACGGTGAGGCTGG - Intergenic
1082068874 11:47922599-47922621 CCTGGGCAACAGAGGGAGATAGG - Intergenic
1082677604 11:56126775-56126797 CTAGGGCTGCTGATGGAGGATGG + Intergenic
1082740064 11:56900964-56900986 CCTGTGAAGCAGAGGGAGCAAGG + Intergenic
1082866190 11:57902051-57902073 CGACAGCTGCAGAGGGAGGAGGG - Intergenic
1083574992 11:63784027-63784049 CCTGGGCTACAGAGTGAGCCGGG + Intergenic
1083593866 11:63909892-63909914 CCGGGGCTGCTGAGGCTGGAGGG + Exonic
1083616345 11:64028414-64028436 TCCACGCTGCAGAGGGAGGAGGG + Intronic
1083628957 11:64086050-64086072 CCAGGGCTCCATAGGGAGGGAGG - Intronic
1083712040 11:64555501-64555523 CGTGGGCTTCTGAGTGAGGAAGG - Intergenic
1083859937 11:65414826-65414848 TATGGGTTGCAGAGGGAGCACGG - Intergenic
1084289515 11:68152777-68152799 CCCGTGCTGCAGAGAGGGGAAGG - Intergenic
1084708416 11:70829409-70829431 CCTGGGCTGCCCAGGGAGAAGGG + Intronic
1084750601 11:71202344-71202366 CCTGAGCTGCAGAGAGTGGCTGG - Intronic
1085071193 11:73547552-73547574 CTTGGGATGCAGAGGCAGGAGGG + Intronic
1085457268 11:76672121-76672143 CCTGAGCTGCAGTGAGGGGATGG + Intergenic
1085533847 11:77206604-77206626 CCTCAGGTGGAGAGGGAGGAAGG - Intronic
1085820377 11:79786689-79786711 GATGGGCGGCAGAGGGTGGAGGG + Intergenic
1086036230 11:82417903-82417925 CTTGGGCGGCTGAGGTAGGAGGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086353005 11:85962198-85962220 GTTGCGCTGAAGAGGGAGGAGGG - Intronic
1088541567 11:110919043-110919065 GCTGGTCTCCAGAGGCAGGAGGG + Intergenic
1088857724 11:113771391-113771413 CCTGGGCTGGAGTGGGGGCAGGG + Intronic
1088893372 11:114060863-114060885 CCTGGGTCGGAGAGGGAGGGCGG + Intronic
1089022079 11:115226649-115226671 ACTTGTCTGCAGAGAGAGGACGG + Intronic
1089200953 11:116724475-116724497 ACTGGGCTGCAGGGAGGGGAAGG + Intergenic
1089617987 11:119705938-119705960 CCTGGGCCTGAGAGGGAGGCGGG + Intronic
1089650766 11:119911228-119911250 CTTCAGCAGCAGAGGGAGGAGGG + Intergenic
1089776272 11:120838860-120838882 CCTGGGAGGCAGAGGTTGGAAGG - Intronic
1089848417 11:121476815-121476837 CCTGGGTGACAGAGCGAGGAAGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090226036 11:125072897-125072919 CCTGGCCTCCAGAGGGATGGAGG - Intronic
1090236903 11:125154912-125154934 ACTGTGCTGCACAGGGAGGGTGG - Intergenic
1090245271 11:125211722-125211744 TTTGGGCTGCAGGGGGAGGTGGG + Intronic
1090251386 11:125254295-125254317 CCAGGGCTGCAAAGGGGCGATGG + Intronic
1090267804 11:125364501-125364523 CTTGGGATGAAGAGGGATGAAGG - Intronic
1090419468 11:126564281-126564303 CCTGGGCTGCAGACGGTGGATGG - Intronic
1090502350 11:127273685-127273707 CCAGGTCTGGAGAGGCAGGAGGG + Intergenic
1090536024 11:127642667-127642689 CCGGGGCTGTAGAGAGGGGAAGG + Intergenic
1090949868 11:131464096-131464118 GAGGGGCTGCTGAGGGAGGAGGG + Intronic
1091230469 11:133984769-133984791 CCAGGGGTGCAAAGGGAGCAGGG + Intergenic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091776527 12:3188463-3188485 CCTGGGTGGCAGAGGAAGGGAGG + Intronic
1091781514 12:3216978-3217000 CCTGAACTGCAGTTGGAGGAAGG + Intronic
1092135904 12:6146845-6146867 ACAGGGCTGGAGAGGTAGGAAGG + Intergenic
1092334243 12:7614867-7614889 CCTGGGTGACAGAGTGAGGAAGG + Intergenic
1092350096 12:7749224-7749246 CCTTGGCTCTTGAGGGAGGATGG + Exonic
1092646341 12:10577689-10577711 CCAGGGCCTCAGAGAGAGGAAGG + Intergenic
1092926160 12:13274440-13274462 CCTGGAATGCACCGGGAGGATGG + Intergenic
1093435335 12:19129736-19129758 CCGCGGCTGCCGAGGGAGGAGGG - Intronic
1094486350 12:30928455-30928477 ACTGGGCTGAAGAAGGAGGGAGG + Intronic
1096154601 12:49334986-49335008 CACAGGCTGCAGAGGGAGGTTGG - Intronic
1096367154 12:51037796-51037818 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
1096836936 12:54357164-54357186 CTTGGGCTACAGAGAGGGGAAGG - Intergenic
1097108003 12:56636377-56636399 ACTGGGGTGGGGAGGGAGGAGGG + Exonic
1097185715 12:57195288-57195310 CCAGGGCAGGAGAAGGAGGAGGG - Exonic
1097189183 12:57211418-57211440 CCTGGGATGCTGAGGAAGGGAGG - Intronic
1097282084 12:57851224-57851246 TGAGGGCTGCAGAGGGAGGGAGG + Intergenic
1098223259 12:68292717-68292739 CCTGGGGTGAAGATGGGGGAGGG + Intronic
1098904889 12:76151664-76151686 CCTGGGAGGCAGAGGGAGGTTGG + Intergenic
1100635382 12:96430553-96430575 CTTGGGAGGCTGAGGGAGGAGGG + Intergenic
1102495589 12:113316809-113316831 CCTGAGCTGCAGTGAGAGGTGGG + Intronic
1102596647 12:113998043-113998065 CTTGGGAGGCAGAGGCAGGAGGG - Intergenic
1102655804 12:114481333-114481355 CTGGCGCTGCAGAGGGAGGAAGG + Intergenic
1102865785 12:116373027-116373049 CCTGGGCTGCTGCGGGAGAGTGG - Intergenic
1103367038 12:120390876-120390898 GCCAGGCTGGAGAGGGAGGAAGG - Intergenic
1103415101 12:120738171-120738193 CCTGAGCTTCTGAGGGAGGTGGG + Intronic
1104211856 12:126696603-126696625 GCTGAACTGCAGAGGCAGGAAGG + Intergenic
1104339886 12:127938446-127938468 CCTGAACTTCAAAGGGAGGAAGG + Intergenic
1104610062 12:130220344-130220366 GCTGGGCTGGAGAGGAGGGAAGG + Intergenic
1104718747 12:131033139-131033161 CCTGGTCTGCACACGGAGGGTGG - Intronic
1104735965 12:131136229-131136251 CTAGGGCTGCAGGGGCAGGAGGG + Intronic
1104974999 12:132548349-132548371 CCTGGGCAGCAGAGGGCAGCTGG + Intronic
1105510140 13:21044835-21044857 CATGGGATGCTGAGGCAGGAGGG - Intronic
1105899333 13:24742287-24742309 CCTGGGCTGGGGAGGAAGAACGG + Intergenic
1106286742 13:28324505-28324527 CCGGGGTTGCAGAGGGAGGCAGG + Intronic
1107008748 13:35646242-35646264 CATGGCCTGCAGGGGAAGGAGGG - Exonic
1107549965 13:41464945-41464967 CCTGGGCAGGAGAGGGTGGGGGG + Intronic
1108005410 13:45941425-45941447 CCCCAGCTGCAGAGGGAGGCTGG - Intergenic
1108707254 13:53000860-53000882 TCTGGCCTGCAGATGGAGCAAGG + Intergenic
1108785201 13:53891877-53891899 ACTGGGCTGTAGAGGAAGGTAGG + Intergenic
1110273535 13:73617446-73617468 CCAGGGTTGGAGAGGGAGAAGGG - Intergenic
1110870930 13:80451970-80451992 CCTGGGTCCCAGAGGGTGGAGGG - Intergenic
1110972057 13:81776204-81776226 CCAGGGGTTCAGAGGGAGAAAGG - Intergenic
1112638525 13:101245143-101245165 CAGGGGCTGCAGACTGAGGAGGG - Intronic
1114131916 14:19801235-19801257 CCTCGGCTGCTGTGGGAGCAGGG + Intronic
1114500387 14:23164078-23164100 CCTGGGAGGCTGAGGTAGGAGGG - Intronic
1115430315 14:33309898-33309920 CTGGCCCTGCAGAGGGAGGAGGG + Intronic
1116203863 14:41835616-41835638 CCTGGGATGCTGAGGTGGGAGGG + Intronic
1116240076 14:42329394-42329416 GCTGGGGTGGAGAGGCAGGAAGG - Intergenic
1116936681 14:50747706-50747728 CCTAGGCAACAGAGGGAAGAAGG + Intronic
1117531035 14:56661094-56661116 CCTGGGCAGTAGTGGGAGGGAGG - Intronic
1117695910 14:58362581-58362603 CCTGGGCAACAGAGTGAGGTGGG - Intronic
1117726744 14:58682240-58682262 CCTGGGGAGCAAAGGGAGGGAGG - Intergenic
1117868419 14:60172984-60173006 CCTGCGCTGCAGGGACAGGAAGG - Intergenic
1118221701 14:63860329-63860351 TCTGGGCTGCATTAGGAGGAGGG + Intronic
1118470987 14:66075181-66075203 CTCAGGCTGCAGAGGGAGGCAGG - Intergenic
1118570719 14:67192089-67192111 GCTGCGCTGCAGAGCGAGGGTGG - Intronic
1118759551 14:68871673-68871695 GCTGGGCTGCAGGGAGAGGAGGG + Intergenic
1118774087 14:68962529-68962551 GCTGGGGTGTGGAGGGAGGAGGG - Intronic
1119208230 14:72810449-72810471 TCCGGGCTGCAGAGGAAGGTGGG + Intronic
1119224519 14:72934626-72934648 CCTGGGCTGGAGGTGGGGGAGGG - Intronic
1119663235 14:76466026-76466048 CCTTGCCTGCAGAGCCAGGAGGG - Intronic
1120802839 14:88711835-88711857 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
1121409268 14:93737969-93737991 CAGGGGATGCTGAGGGAGGAAGG + Intronic
1121526204 14:94621156-94621178 CCTGGGATCTAGAGTGAGGAGGG - Intronic
1121597851 14:95179522-95179544 CCCAGGCTGCGGATGGAGGAAGG + Intergenic
1121623183 14:95364415-95364437 CCTGGGGTGTGGGGGGAGGAGGG + Intergenic
1122121367 14:99555228-99555250 CCTGGTCTCAACAGGGAGGATGG + Intronic
1122257001 14:100485703-100485725 CATGTGTTCCAGAGGGAGGAGGG + Intronic
1122278001 14:100605105-100605127 CCTGGTCTCCACAGGGAGGAGGG + Intergenic
1122348281 14:101073636-101073658 CTGGGGCTGCAGAGGGAGGCCGG - Intergenic
1122637215 14:103135792-103135814 CCTGGGCTGCAGAGGGCAGATGG - Exonic
1122698199 14:103568349-103568371 CCTGGCCTGCAGAGCCAGCATGG + Intronic
1122772512 14:104103692-104103714 TCAGGGCTGCAGGGGCAGGATGG - Intronic
1122779787 14:104138775-104138797 CCCGGCCTGGAGAGGGAGGCGGG + Intronic
1122835262 14:104427659-104427681 CCTGGGGTGCAGGGGGAGTGAGG - Intergenic
1122942744 14:104989718-104989740 CCAAGGCCCCAGAGGGAGGAGGG + Intronic
1122983630 14:105202441-105202463 CCTAGGCTGGAGAGGGCAGAGGG + Intergenic
1123062957 14:105602397-105602419 ACTGGGCTCCAGGGGCAGGATGG - Intergenic
1123163303 14:106301311-106301333 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1123574990 15:21656939-21656961 CCTGGGCTGCTGTGGGAGCGGGG + Intergenic
1123611606 15:22099428-22099450 CCTGGGCTGCTGTGGGAGCGGGG + Intergenic
1124291486 15:28456668-28456690 CCTGGGCAGTAGAGACAGGAGGG + Intergenic
1124375844 15:29128210-29128232 CCTTAGCAGCAGAGGGAGAAAGG - Intronic
1125082780 15:35695257-35695279 CCTGGTCTGAAGAGGTAGCATGG + Intergenic
1126098618 15:45106495-45106517 GCTGGGCAGAGGAGGGAGGAGGG - Intronic
1126166680 15:45659504-45659526 CCCAGGCTGCAGAGGGAGCATGG - Intronic
1126949647 15:53867432-53867454 GCTGGGCTGCGGAGAGAGGGAGG - Intergenic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128090472 15:64915635-64915657 CCTGACCTTGAGAGGGAGGAGGG + Intronic
1128524952 15:68406086-68406108 CCAGGCCTGCAGAGGGGTGAGGG + Intronic
1128569908 15:68726459-68726481 CCGGGGCTGCTGAGGGAAGAGGG - Exonic
1129140333 15:73592173-73592195 CCAGGGCTACAGAGGATGGAAGG - Intronic
1129277889 15:74459414-74459436 CCTGGGAGGCTGAGGCAGGAAGG - Intronic
1129543763 15:76373581-76373603 TCTGTGCTGTAGAGGTAGGAGGG + Intronic
1129743063 15:77999551-77999573 CCTGGTCTGCAGAGCCAGGCAGG - Intronic
1129824928 15:78628668-78628690 CCTGGGAAGCACAGTGAGGAAGG - Intronic
1130140419 15:81221581-81221603 CCTGGCATCGAGAGGGAGGAAGG - Intronic
1130303589 15:82698689-82698711 CCTGGGCTTCCGTGGAAGGAGGG + Intronic
1130551998 15:84895197-84895219 CCAGGGCTGGAGGAGGAGGAAGG + Intronic
1130906598 15:88244959-88244981 CTGGGGCTGCAGAGTGGGGAAGG + Intronic
1131068828 15:89451279-89451301 CCTGGGCTTCAGATGCAGGTGGG - Intergenic
1131112016 15:89770482-89770504 TCTGGGCTGCAGAGTGAGACAGG - Intronic
1131359930 15:91781639-91781661 CCTAGGCAGCAAAGGGAGAATGG - Intergenic
1131393362 15:92067305-92067327 CACGGGAAGCAGAGGGAGGAGGG - Intronic
1131512836 15:93058878-93058900 CCAGGACTGCATAGGGAGGTTGG + Intronic
1132071011 15:98776591-98776613 CCTGGGCTCAACAGGGAGGTAGG - Intronic
1132160149 15:99533792-99533814 CCTGGGCAACAGAGGGAGAGAGG - Intergenic
1132329856 15:101004735-101004757 CCTGAACTGCAGAAGGAGCAGGG - Intronic
1202983858 15_KI270727v1_random:391183-391205 CCTGGGCTGCTGTGGGAGCGGGG + Intergenic
1132621082 16:868594-868616 CCTGGCCTGGAGAGGCAAGAAGG - Intronic
1132650437 16:1019115-1019137 GCTGGGCTCCAAAAGGAGGAGGG - Intergenic
1132869160 16:2108022-2108044 CTCGGCCTGCAGAGGGAGGCTGG - Exonic
1132875576 16:2135565-2135587 GCTGGGCCGCAGAGGCAGGGGGG + Exonic
1132878997 16:2153007-2153029 CGTGTGGTGAAGAGGGAGGACGG + Exonic
1132995402 16:2820014-2820036 CCTGGGCTGGGGAGAGAGGGTGG - Intronic
1132998365 16:2836151-2836173 CCTGGGCTCCAGGGTGAGGAAGG + Intronic
1133206084 16:4234501-4234523 TCAGGGCTGCAGAGGGATGAGGG + Intronic
1133212818 16:4272610-4272632 CGGGGGCTGCAGTGGTAGGAAGG + Intronic
1133296097 16:4753034-4753056 CCTGGGATCCAGTTGGAGGACGG - Exonic
1134080201 16:11319699-11319721 CCTGCTCTGCAAAGGGAGGATGG - Intronic
1134255742 16:12609980-12610002 CTTGGGAGGCTGAGGGAGGATGG - Intergenic
1134398432 16:13886978-13887000 CCTGGGCTGAAGGGGGATGCAGG + Intergenic
1134550212 16:15135419-15135441 CTCGGCCTGCAGAGGGAGGCTGG - Intronic
1134718257 16:16367576-16367598 CTCGGCCTGCAGAGGGAGGCTGG + Intergenic
1134956495 16:18384583-18384605 CTCGGCCTGCAGAGGGAGGCTGG - Intergenic
1135314406 16:21432332-21432354 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135367328 16:21864608-21864630 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1135444485 16:22506550-22506572 TCTGGATTCCAGAGGGAGGAAGG - Intronic
1135607685 16:23837271-23837293 CCTGGGGTACAGAGGCAGGGAGG + Intronic
1135668364 16:24354425-24354447 GCTGGGCTGAGGAGGGAGAATGG + Intronic
1136267898 16:29131675-29131697 CCCGGGCTGCGGAGCCAGGAAGG + Intergenic
1136311075 16:29411027-29411049 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136324519 16:29512818-29512840 TCTGGATTCCAGAGGGAGGAAGG + Intergenic
1136421664 16:30138126-30138148 CCTGCGCTGCAGTGGCAGGAGGG + Intergenic
1136439204 16:30252799-30252821 TCTGGATTCCAGAGGGAGGAAGG + Intronic
1136655519 16:31706874-31706896 CTGGGGCTGCAGAGGGACCAGGG - Intergenic
1136772006 16:32848219-32848241 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1136898604 16:34013302-34013324 CCTGTTCTGCAGAGGTAGGGAGG + Intergenic
1136910672 16:34141847-34141869 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1136922799 16:34345888-34345910 CCAGAGCTGGGGAGGGAGGATGG - Intergenic
1136981774 16:35065918-35065940 CCAGAGCTGGGGAGGGAGGATGG + Intergenic
1137733793 16:50709558-50709580 CATGGGGTGCATGGGGAGGATGG + Intronic
1138671387 16:58617899-58617921 CTTGGGCTGCTGTGGGAGGATGG + Intronic
1139312456 16:66039326-66039348 CCTGGGCTCCAGAGAAAAGAAGG + Intergenic
1139354956 16:66362012-66362034 TTTGGGTTGCAGAAGGAGGAAGG + Intergenic
1139474617 16:67196846-67196868 GGTGGGCAGCAGAAGGAGGAGGG - Intronic
1139516002 16:67452757-67452779 CCTGGACTGCACAGGGAGGTAGG - Intronic
1139558510 16:67727625-67727647 CCAGGTCTGCAGAGGGAAGTGGG - Intronic
1139592744 16:67942582-67942604 GCTGGCCTGCAGCGGGTGGAAGG + Exonic
1139710843 16:68774712-68774734 CCTGGGCAGCAGCTGGAGGGTGG + Intronic
1140177660 16:72679951-72679973 CAGGGGCTGCAGGGTGAGGAGGG + Intergenic
1140734208 16:77883765-77883787 CATCGGATGAAGAGGGAGGAGGG - Intronic
1141202448 16:81908394-81908416 CCTGGGCCGCAAAGAGAGGAGGG - Exonic
1141283910 16:82653618-82653640 GCAGGGCTGCAGGGGTAGGAGGG + Intronic
1141413106 16:83849655-83849677 CCTGGGGTGCAGATGGAAGAGGG + Intergenic
1141434970 16:83994771-83994793 TCTGGGCTGCAGAGGGGCCAGGG + Intronic
1141498404 16:84426227-84426249 CAGGGGCAGGAGAGGGAGGAAGG + Intronic
1141675632 16:85515841-85515863 CCTTGGCAGAAGAGGCAGGAGGG - Intergenic
1141692701 16:85605642-85605664 CCGGGGGTGCAGGGGGAGGATGG - Intergenic
1141717461 16:85735082-85735104 TCTGCCCTGCAGAGGGAGCAGGG - Intronic
1141757035 16:85998143-85998165 CAGGGGTGGCAGAGGGAGGAGGG - Intergenic
1141774773 16:86115974-86115996 CCTGCAAAGCAGAGGGAGGATGG - Intergenic
1141788888 16:86219581-86219603 CCTGGGCAGCACAGGGTGGGAGG - Intergenic
1141863046 16:86731013-86731035 CACTGGCTGCAGCGGGAGGATGG + Intergenic
1141923230 16:87150417-87150439 CCAGGGGTGAACAGGGAGGAAGG + Intronic
1142008260 16:87700639-87700661 GCTGGAGGGCAGAGGGAGGAGGG + Intronic
1142009141 16:87704919-87704941 CATGGGCGGCAGGGGGAGCATGG + Intronic
1142065021 16:88057398-88057420 CCTGGCCTCCAGAGGAAGGATGG + Intronic
1142071204 16:88092022-88092044 CCCGGGCTGCGGAGCCAGGAAGG + Intronic
1203074427 16_KI270728v1_random:1110308-1110330 CCTGTTCTGCAGAGGTAGGGAGG - Intergenic
1203141842 16_KI270728v1_random:1771910-1771932 CCTGGGATTGAGATGGAGGAAGG - Intergenic
1142592365 17:1011985-1012007 CCTGGGGTGGAGCGTGAGGATGG + Exonic
1142604460 17:1073887-1073909 GCAGGGCTGCGGAGGGAGCAGGG - Intronic
1142746304 17:1960433-1960455 ACGGGGCTGGAGAGGGAGGTGGG - Intronic
1143115803 17:4581398-4581420 CCTGGGGTGCAGAGGGCTGGAGG + Intergenic
1143368392 17:6423049-6423071 TATGGCCTGCAGAGGGAGCAAGG - Intronic
1143419665 17:6778936-6778958 CCTGGGGGACAGAGGAAGGATGG - Intronic
1143498420 17:7325294-7325316 CCTGGGCGGCAGGGGCAGCACGG + Exonic
1143642877 17:8209511-8209533 TCTTGGCTGCAGAAGAAGGAAGG - Intronic
1143645648 17:8228417-8228439 CCTGGGAGGAAGAGGGATGAGGG - Intronic
1144347173 17:14359758-14359780 CCTGGGCTGCAAAAGGAGGGAGG - Intergenic
1144523351 17:15969066-15969088 CCTCAGCTGCAGTGGAAGGAAGG - Intronic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144882694 17:18438803-18438825 ACTTGGCTGCAGTGGCAGGACGG + Intergenic
1144950680 17:18991964-18991986 CCTGGGGGGCAGAGGCAGGCAGG + Intronic
1144960879 17:19043243-19043265 CCCAGGCTGCAGGGGCAGGAAGG - Intronic
1144974281 17:19131281-19131303 CCCAGGCTGCAGGGGCAGGAAGG + Intronic
1145757687 17:27404675-27404697 CCTGGTCTGGAGAGGGAGGAGGG - Intergenic
1145774516 17:27518763-27518785 CCTTTGGTGGAGAGGGAGGAGGG - Intronic
1146627466 17:34445340-34445362 CTTGGACTGCAGAGGGTGGAGGG - Intergenic
1146640763 17:34539644-34539666 CTTGGGCTTCAGAGCCAGGAAGG - Intergenic
1146656314 17:34637225-34637247 CGTGGGCTGTAGAGGGAGAGTGG - Exonic
1146662676 17:34675028-34675050 CATGTGCAGCAGAGTGAGGAGGG - Intergenic
1147343618 17:39771669-39771691 CCTGGAGTGCAGAGGGAGGATGG + Intronic
1147905148 17:43817904-43817926 CATGGACTCCAGAGGAAGGAGGG - Intronic
1147909837 17:43848927-43848949 CAGGAGCTGCAGAGGGAAGAGGG + Intronic
1148145555 17:45362426-45362448 CCCGGGTGGCTGAGGGAGGAGGG - Intergenic
1148435591 17:47681938-47681960 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
1148467357 17:47872920-47872942 CCGGGGCTGGAGAGGGCGGAAGG + Intergenic
1148480438 17:47956517-47956539 CCTGGGCAGAAGAGACAGGAAGG - Intronic
1148503001 17:48106188-48106210 CAAGGGCTGAGGAGGGAGGATGG + Intronic
1148525362 17:48327731-48327753 CTTGGGAGGCTGAGGGAGGACGG - Intronic
1148755498 17:49970986-49971008 CCTGGGCTGCGGAGTGTGGCTGG + Intronic
1149546345 17:57506598-57506620 CCTGGCCTTCCGAGGGAGTAGGG + Intronic
1149955292 17:61042780-61042802 CCTGGGAGGCTGAGGCAGGAGGG + Intronic
1150139172 17:62714168-62714190 CCTGTGCGGCAGAGCAAGGATGG + Intronic
1150211194 17:63442487-63442509 CCAGGGCTGCCCAGTGAGGAGGG - Intronic
1150251048 17:63704604-63704626 CCTGGGCTGTAGCGGGTGGGGGG + Intronic
1150282123 17:63934775-63934797 CCTGGGCTGGAGAAGGAGGCAGG - Intergenic
1151239896 17:72749611-72749633 CCTGGGCAGCAGAGGTGGGCAGG + Intronic
1151422056 17:74005164-74005186 GCTGGGCTTCAGAGGGTGGGTGG - Intergenic
1151531294 17:74706819-74706841 CCCGGGCTGGAGTGGAAGGAGGG - Intronic
1151560330 17:74866392-74866414 CAGGGGCTGCAGAAGGAGGCCGG - Intronic
1151626020 17:75276391-75276413 CCTGGGCAACAGAGCAAGGAAGG - Intronic
1151702267 17:75749849-75749871 CCTGAGCTGCCAAGGGAGAAAGG + Intronic
1151950386 17:77350259-77350281 TGTGGGCTGCACAGGAAGGAGGG - Intronic
1152041493 17:77906607-77906629 CCTGGTCTGCCCAAGGAGGAAGG + Intergenic
1152244654 17:79178957-79178979 ACTGGCCAGCGGAGGGAGGAGGG - Intronic
1152353661 17:79796847-79796869 GCTGGGCTGCAGCAGGGGGAGGG + Intronic
1152380699 17:79941102-79941124 CCTCGCCTGCAGACAGAGGACGG + Exonic
1152443890 17:80329090-80329112 CCTGGGCTGCAGACGTAGGGTGG + Intronic
1152469606 17:80483354-80483376 CTGAGGGTGCAGAGGGAGGACGG + Intergenic
1152564228 17:81093029-81093051 CCTGGGTTCCAGATGCAGGATGG - Intronic
1152608379 17:81304034-81304056 CCTGGCATGCAGAGAGAGAAGGG - Intergenic
1152756682 17:82089962-82089984 CCTTGGCTGCAGAGGACTGAGGG - Intronic
1152911235 17:83005933-83005955 CCTGAGATCCAGAGGTAGGAGGG + Intronic
1153205222 18:2692103-2692125 CTTGGGCTGCAGAGGTTGGAAGG - Intronic
1153587388 18:6637126-6637148 AACTGGCTGCAGAGGGAGGATGG - Intergenic
1155308094 18:24498668-24498690 CTTGGCCTGCCGAGGGTGGAGGG + Intergenic
1156183177 18:34629911-34629933 ACTGGGCTGCTGAGGAAGCATGG - Intronic
1156326572 18:36079224-36079246 CCTGGGCTCAAGCGGGAGAATGG - Intergenic
1156332307 18:36134019-36134041 CCTGGGCTACAGAGCAAGGCAGG - Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157499817 18:48181708-48181730 CCAGGGCTTCAGTGGGAGTAAGG - Intronic
1158099856 18:53818947-53818969 CCTGGGCTGGAGGAGGAGGAAGG + Intergenic
1158425927 18:57339565-57339587 CCTGGGCTTCAGGAGGAAGATGG + Intergenic
1158452622 18:57580726-57580748 GGTGGGGTGCAGTGGGAGGAGGG - Intronic
1158981466 18:62765970-62765992 CCTGGGCGACAGAGCGAGAAGGG + Intronic
1160242506 18:77133266-77133288 CCTGGGCTCCAGGGGAGGGAGGG - Intronic
1160286946 18:77551885-77551907 CCTGGGCAACAGAGGGAGCCCGG - Intergenic
1160400314 18:78605964-78605986 CTTAGGATGCAGAGGGAGGATGG - Intergenic
1160486628 18:79299298-79299320 GAAGGGCTGGAGAGGGAGGAGGG - Intronic
1160507330 18:79434430-79434452 CCTGGGGTGCAGAGGGAGCATGG - Intronic
1160543740 18:79639303-79639325 CCTGAATTCCAGAGGGAGGAGGG - Intergenic
1160688407 19:448324-448346 CCGGGGCTTCAGAGGGAGCGAGG - Intronic
1160726679 19:620709-620731 CCGGAGCTGCCGGGGGAGGAGGG + Intronic
1160803197 19:979876-979898 CCTTGGCTGGGGAGGGAGGTGGG - Intergenic
1160803222 19:979931-979953 CCTTGGCTGGGGAGGGAGGTGGG - Intergenic
1160803247 19:979986-980008 CCTTGGCTGGGGAGGGAGGTGGG - Intergenic
1160867061 19:1260663-1260685 CCAGGGGTGCAGCGGGCGGAGGG + Intronic
1160978792 19:1807080-1807102 CCTGGGCGAGAGTGGGAGGAGGG - Intronic
1161085370 19:2332740-2332762 CCCGGCCTGCACAGGGAGGAGGG - Intronic
1161197135 19:2993305-2993327 CCAGGGCTGCACAGCTAGGAAGG + Intronic
1161198500 19:3000773-3000795 CCCGGGCTGCAGGGGGAGGTCGG + Intronic
1161227083 19:3151648-3151670 CCTGGGAAGCAAAGGGAGGCTGG + Intronic
1161242619 19:3230879-3230901 CCTGTGCTTCACATGGAGGAGGG - Intronic
1161326539 19:3667048-3667070 TCAGGGCTGCAGGGGCAGGAAGG - Intronic
1161386306 19:3995397-3995419 CTTGGGATGCTGAGGCAGGAGGG + Intergenic
1161440827 19:4290738-4290760 TCTGGGCTACAGAGGGAAGTGGG + Intergenic
1161464020 19:4417424-4417446 CCTGGGCGACAGGGAGAGGATGG - Intronic
1161469962 19:4452288-4452310 CCTGGGCTTCCGATGGAGGGTGG + Intronic
1161621746 19:5301389-5301411 CCTGGGAGGCAGAGGGTGCAGGG - Intronic
1161636487 19:5392568-5392590 CCTCCGCTGGAGAGGCAGGAAGG - Intergenic
1162135426 19:8552200-8552222 CCTGGGGTGCAGGTGGGGGAAGG + Intronic
1162182018 19:8876431-8876453 ACTGAGCTGCAGAGGGAGAAGGG + Exonic
1162182036 19:8876503-8876525 GCAGGGCTGCAGCGGGAGGCAGG + Intronic
1162186976 19:8913460-8913482 GTGGGGCTGGAGAGGGAGGATGG + Exonic
1162311905 19:9913103-9913125 AGTGGGGTGCAGCGGGAGGAGGG - Intronic
1162496289 19:11025003-11025025 CCTGGGCTCCAGGATGAGGAAGG - Intronic
1162918963 19:13889289-13889311 CCTGGTCTGCAGAATGAGGCAGG + Exonic
1162966909 19:14160440-14160462 CCTGGCCTACAAAGGGAGCAGGG - Intronic
1163258987 19:16175411-16175433 CCTGGGAGGCTGAGGAAGGAGGG - Intergenic
1163419589 19:17206567-17206589 CCTGGGCACCACAGGGTGGATGG + Intronic
1163446214 19:17347855-17347877 GCTGGGCTTCAGAGGTAGAAGGG + Intergenic
1163631752 19:18421107-18421129 CCTAGGCAGAAGAGGCAGGATGG - Intronic
1163786174 19:19275972-19275994 ACTGTGCTGCAGAGGGAGGTTGG - Intergenic
1163821637 19:19499541-19499563 CCCAGGATACAGAGGGAGGAGGG + Intronic
1164137355 19:22427249-22427271 AGTGGGCTGCGGAGGCAGGAAGG - Intronic
1164189323 19:22900583-22900605 GCTGGGCTCCAGAGAGAGGAAGG + Intergenic
1164596510 19:29533879-29533901 CCTGAGCTGCAGAGGGAGCTCGG + Intronic
1164702819 19:30297904-30297926 CCTGGGCGACAGAGGGGGGGGGG - Intronic
1164713181 19:30373857-30373879 CCTGAGCTGCAGTGGGAGCCGGG + Intronic
1164761499 19:30731763-30731785 CCAGGGCTGATGATGGAGGAGGG - Intergenic
1164763230 19:30743821-30743843 CCTGGGCTGCAGAGGCAGCTAGG + Intergenic
1164854608 19:31511309-31511331 CCTGGGTTGGAGAGGGAGAGAGG - Intergenic
1165021307 19:32926585-32926607 CCTGGGCGGCAGAGTGGGAATGG - Intronic
1165166884 19:33863269-33863291 TCAGGGCTGCAGGGGGAGGGTGG + Intergenic
1165263126 19:34637446-34637468 CCTGGGATGCTGAGGTATGAGGG + Intronic
1165308337 19:35015760-35015782 CGTGGCCCGCAGAGGGAGGGAGG + Intronic
1165907653 19:39203619-39203641 CCTGGGCTGCAGGTGGAGTGGGG + Intronic
1165920440 19:39294301-39294323 CCTGGGCTGCATATGGAATAGGG + Intergenic
1166147399 19:40847052-40847074 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166151548 19:40878937-40878959 CTGGGGTTGCAGAGAGAGGATGG + Intronic
1166170420 19:41024441-41024463 CTGGGGTTGCAGAGAGAGGATGG + Intergenic
1166178639 19:41091709-41091731 CTGGGGTTGCAGAGAGAGGATGG - Intronic
1166366845 19:42282126-42282148 CTGGGGCTGCATAGGAAGGAGGG + Intronic
1166516264 19:43449295-43449317 CCAAGGCTGAGGAGGGAGGATGG + Intergenic
1166690969 19:44821045-44821067 CCTTGCCGGCAGAGGAAGGAAGG - Exonic
1166733136 19:45069791-45069813 CCTGGGGAACAGAGGGAGGCAGG - Intronic
1166794847 19:45420029-45420051 CCTGGGGATCTGAGGGAGGAGGG - Intronic
1166816672 19:45550512-45550534 CCCCAGCTGCAGAGTGAGGAGGG - Intronic
1167097960 19:47385389-47385411 GCTGGGCTGCAGCGGGTGGAGGG - Intergenic
1167169898 19:47824095-47824117 CCTGGCCTGCAGTGGGAGCAGGG + Intronic
1167340646 19:48913843-48913865 CCTGGGCTGCTGTGGGCAGAGGG - Intronic
1167397811 19:49243149-49243171 CCTGGGCTGTGGTGGAAGGAAGG - Intergenic
1167411738 19:49348067-49348089 TCTGGCCAGCAGATGGAGGAAGG - Intronic
1167471455 19:49678161-49678183 CCTGGCGGGCGGAGGGAGGAGGG + Intronic
1167502547 19:49856080-49856102 CCTGGTCTCCTGAGGGAGAAGGG - Intronic
1167972356 19:53196579-53196601 CCTGGGGTGTGGAGCGAGGAGGG + Intergenic
1168165112 19:54541856-54541878 CCTGGGCTGAGAAGGGACGAGGG + Intronic
1168312028 19:55465208-55465230 CCTGAGCAGCAGAGTGAGGGAGG + Intergenic
1168518742 19:57031695-57031717 CGGGGGCAGCAGAGGGAGGAAGG - Intergenic
1168644506 19:58051481-58051503 GCTGGGCTAGAGACGGAGGAGGG - Intronic
925055344 2:852990-853012 CCTGAACTCCACAGGGAGGAGGG + Intergenic
925079660 2:1053972-1053994 CAGGGCCTGCAGAGGGAGGAGGG - Intronic
925093429 2:1173670-1173692 CCCAGGCTTCTGAGGGAGGAGGG - Intronic
925111349 2:1341076-1341098 CTTTGGCTGCCAAGGGAGGATGG + Intronic
925149006 2:1601734-1601756 GCTGGGCTGCAGAGGGGTCAAGG + Intergenic
925173406 2:1766590-1766612 CCCAGCCTGCAGAGGGAGCAGGG + Intergenic
925428493 2:3771132-3771154 CGGAGGATGCAGAGGGAGGACGG - Intronic
926075661 2:9940986-9941008 CCTGGGCAGCAGTGGGAGATGGG - Intergenic
927148099 2:20180057-20180079 CATGGGCTGGAGTGGGAGGATGG - Intergenic
927466802 2:23342892-23342914 GGTGGGCTGGAGAGCGAGGAAGG + Intergenic
927513317 2:23658084-23658106 AGTGGGCAGGAGAGGGAGGAGGG - Intronic
927714600 2:25343322-25343344 GCTGGGCTGCATGGGGAGAAGGG - Intergenic
927780950 2:25939017-25939039 CCTGGGTGACAGAGTGAGGAAGG - Intronic
927879315 2:26679545-26679567 GCTGGGCTGGAGAGGTAGGCAGG + Intergenic
927988275 2:27428843-27428865 CCTGGGCTACTGAGTGAGCAGGG - Intronic
928023698 2:27723000-27723022 CCTGGGATGCAGAGGTTGAAGGG - Intergenic
928115664 2:28543675-28543697 CGTGGGCTGCAGCGTGATGAAGG + Intronic
928225117 2:29441807-29441829 CCTGGGCTGCAGAGGAACAGTGG - Intronic
928277359 2:29915257-29915279 CCTGGGCAACAGAGTGAGAAAGG - Intronic
928680792 2:33700282-33700304 CGGAGGCTGCAGTGGGAGGAGGG - Intergenic
929526377 2:42706995-42707017 CCTGGGTTACAGAGGGAAGCGGG - Intronic
929903329 2:46024651-46024673 CCTGGACTTCAGAAGGAGGGTGG + Intronic
931173933 2:59834022-59834044 CCTGGGGTGCTGAGGGAGCCTGG - Intergenic
931728980 2:65136358-65136380 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
932221135 2:69999890-69999912 CTTGGGTGGGAGAGGGAGGAAGG - Intergenic
932341748 2:70966899-70966921 CCTGGGCTGCAGAGTGAGACAGG + Intronic
932424382 2:71619862-71619884 CTTGGGCTGCAGCCTGAGGAGGG - Intronic
932595799 2:73092846-73092868 ACTGGGTTGCAGAGGGAGGTGGG - Intronic
932794544 2:74682989-74683011 GTTGGGATGCAGAGGGAGCAGGG - Intronic
934046948 2:88180137-88180159 TCTGGGCTGCAGAGGGCGGCTGG - Intronic
934912822 2:98274959-98274981 CCTGAGGAGCAGAGGAAGGATGG - Intronic
936072766 2:109382421-109382443 GGTGGGCTGCTGAGGGAGGTGGG - Intronic
936289595 2:111211309-111211331 CCTGGGATGCAGAGGTTGCAGGG - Intergenic
937145169 2:119638452-119638474 CCTGGGCTGCAGGGAGGGGCAGG + Intronic
937278820 2:120703591-120703613 ACTCAGCTGCAGAGTGAGGAAGG - Intergenic
937377451 2:121347360-121347382 TCTGGGGTGCAGAAGCAGGAGGG + Intronic
938459140 2:131486356-131486378 CCTGGCCTGCAGAGGGACTGTGG - Intronic
938763608 2:134445850-134445872 CCTGGGCTGCAGAGGCTGTCTGG + Intronic
938817245 2:134917599-134917621 CCGAGGCTGAAGTGGGAGGATGG - Intergenic
938867653 2:135440371-135440393 CCTGGGCGACAGAGCAAGGAAGG + Intronic
940648983 2:156421884-156421906 GGTAGGCTGAAGAGGGAGGAAGG + Intergenic
941003885 2:160227700-160227722 CTTAGGCTGCTGTGGGAGGAAGG + Intronic
941685525 2:168444340-168444362 CCTGGGCTGCAGTGCTAGGATGG - Intergenic
941917880 2:170823849-170823871 CCTGGCCTGCTGAGGGTGGGGGG + Intronic
941918568 2:170828149-170828171 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918704 2:170828733-170828755 CGAGGACAGCAGAGGGAGGAGGG - Intronic
941918735 2:170828853-170828875 CAAGGACCGCAGAGGGAGGAAGG - Intronic
942654029 2:178195415-178195437 CCGGGGATGCTGGGGGAGGAGGG + Intronic
942927979 2:181456812-181456834 CCCGGGCTGCAGAGGAAGTGTGG + Intergenic
945041457 2:205746557-205746579 CCAGCTCTGCTGAGGGAGGAGGG - Intronic
945922820 2:215773302-215773324 CCTGGGCTCTGGAGTGAGGATGG - Intergenic
945942668 2:215965470-215965492 CAGGGGATACAGAGGGAGGAAGG + Intronic
945950128 2:216031379-216031401 CCTGGGCAACAGAGTGAGAAAGG + Intronic
947104598 2:226655409-226655431 CCTGGGGTCCATAGGGAAGATGG - Intergenic
947232697 2:227903694-227903716 CTTGGGCTGGGGTGGGAGGAAGG - Intronic
947267122 2:228295108-228295130 CCTGGGCTGAAACGGAAGGAAGG + Intergenic
947492910 2:230611253-230611275 CCAGGGCAGCAGAGGGTGGAGGG - Intergenic
947669301 2:231926339-231926361 GCTGGGCTGCAGGGCGAGCAGGG + Exonic
947713390 2:232328365-232328387 CCTGAGATGCAGAGGAAGAAGGG - Intronic
947835245 2:233170383-233170405 CCCGGGCTGCAGAGTGATGGTGG - Intronic
948021776 2:234739074-234739096 CCTGAACTGCAAAGGGAGGAGGG - Intergenic
948041151 2:234902593-234902615 TCTGACCTGGAGAGGGAGGAGGG + Intergenic
948062796 2:235053886-235053908 GCGGAGCTGAAGAGGGAGGAAGG + Exonic
948159312 2:235811263-235811285 CCTGGACATCAGAGGCAGGAGGG - Intronic
948186606 2:236026296-236026318 CCTGGCCAGCACAGGGAGCAGGG - Intronic
948202083 2:236136545-236136567 CATGGGCAGCAGAGGAGGGAGGG - Intergenic
948318921 2:237053500-237053522 CCTGGGATCCAGAGGGTGGATGG - Intergenic
948353283 2:237358143-237358165 CCTTGGCCACAGAGGCAGGATGG + Intronic
948378109 2:237535538-237535560 GCCGGGGTGCAGAGGGAGTAGGG + Intronic
948386937 2:237586301-237586323 CATGGGGTGCAGAGGGAAGCAGG - Intronic
948462580 2:238137480-238137502 GCTGGGCTGTAGAGGAAGCATGG + Intergenic
948496417 2:238352572-238352594 CCTGGGCAGCACAGGGACGTGGG + Intronic
948529229 2:238593460-238593482 CCCCGGCTGCTGGGGGAGGAGGG - Intergenic
948575015 2:238944204-238944226 GCAGGGCTGCAGGGGGAGGAAGG + Intergenic
948604192 2:239124301-239124323 CCTGGGCTGCTGCGGGCAGATGG - Intronic
948765344 2:240216558-240216580 CCTGGGGAGCAGGGGGAGGTGGG + Intergenic
948770822 2:240250542-240250564 GGAGGGCTGAAGAGGGAGGAGGG + Intergenic
948805502 2:240452144-240452166 CCTGGGCTGCAGGGAGGGGAGGG + Intronic
948856660 2:240733409-240733431 GCTGGGCTGAGGAGGGAGCACGG - Intronic
948947208 2:241226875-241226897 CCTCGGCTGGAGGAGGAGGAGGG - Intergenic
949032863 2:241805246-241805268 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949032943 2:241805441-241805463 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949032960 2:241805480-241805502 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949032977 2:241805519-241805541 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949032992 2:241805554-241805576 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033008 2:241805593-241805615 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033024 2:241805632-241805654 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033039 2:241805667-241805689 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033055 2:241805706-241805728 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033085 2:241805780-241805802 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033101 2:241805819-241805841 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033117 2:241805858-241805880 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033133 2:241805897-241805919 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033175 2:241806000-241806022 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033223 2:241806117-241806139 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033238 2:241806152-241806174 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033253 2:241806187-241806209 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033267 2:241806222-241806244 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033331 2:241806379-241806401 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033363 2:241806456-241806478 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033379 2:241806495-241806517 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033394 2:241806530-241806552 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033440 2:241806643-241806665 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033456 2:241806682-241806704 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033486 2:241806756-241806778 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033502 2:241806795-241806817 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033580 2:241806986-241807008 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033594 2:241807021-241807043 CCTGGGCTGAGGGGGGAGGGTGG - Intergenic
949033610 2:241807060-241807082 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033626 2:241807099-241807121 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033673 2:241807216-241807238 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033763 2:241807450-241807472 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033795 2:241807527-241807549 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033828 2:241807609-241807631 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033846 2:241807652-241807674 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033863 2:241807691-241807713 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033910 2:241807808-241807830 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033927 2:241807847-241807869 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033944 2:241807890-241807912 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033962 2:241807933-241807955 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949033979 2:241807972-241807994 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949034027 2:241808097-241808119 CCTGGGCTGAGGGGGGAGGGAGG - Intergenic
949043381 2:241859324-241859346 CCTGGGCTGCAGTGAGGGGTGGG + Intergenic
1168816715 20:742849-742871 CCTCCTCTACAGAGGGAGGAAGG - Intergenic
1168965451 20:1895422-1895444 CCGCGGCTGCGGAGCGAGGAGGG - Exonic
1169059841 20:2653220-2653242 ACTGCGCCGCAGAGGCAGGAGGG + Intronic
1169074137 20:2751177-2751199 CTTGGGCTGGGGCGGGAGGATGG - Intronic
1170523687 20:17215312-17215334 CCTGGTCTGCAGAGGCAGGAAGG + Intergenic
1171493349 20:25537696-25537718 CCTGGGCTGCTGCAGGTGGAGGG + Intronic
1171906127 20:30900555-30900577 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1172030001 20:31975109-31975131 CCTGGGGAGAGGAGGGAGGATGG + Intronic
1172080780 20:32338969-32338991 CCTGGGTGACAGAGGAAGGAAGG + Intergenic
1172204834 20:33155880-33155902 CCTGCCCTGAAGAGGGAGGCAGG - Intergenic
1172208890 20:33183706-33183728 CCTGGGCTCCTAAGGGAGAAAGG + Intergenic
1172245821 20:33444114-33444136 GCTGGGCTGCATATGGCGGAGGG + Intergenic
1172852303 20:37975371-37975393 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1172900928 20:38334408-38334430 CCTGGAAATCAGAGGGAGGATGG - Exonic
1172984843 20:38976758-38976780 TAGGGGCTGCAGAGGGAAGAGGG - Intronic
1173707752 20:45124872-45124894 CCGGGGCAGCACAGGAAGGAGGG - Intergenic
1173766117 20:45611199-45611221 CCTAGGGAGTAGAGGGAGGACGG - Intronic
1174055977 20:47798789-47798811 CCTGGTCTGCACAGGGAGCTGGG - Intergenic
1174064165 20:47852746-47852768 CCCTGTCTACAGAGGGAGGAGGG + Intergenic
1174170719 20:48616640-48616662 CCCGTGCTGCAGTGGGAGCAGGG - Intergenic
1174791915 20:53486841-53486863 CTGGGGCTGGGGAGGGAGGAAGG - Intronic
1174913874 20:54635088-54635110 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1175330273 20:58158790-58158812 CCAGGGGTCCAGAGGGAGGGAGG - Intronic
1175503569 20:59466903-59466925 CTGGGGCTGCAGGGGCAGGAGGG + Intergenic
1175569699 20:60009550-60009572 CCTGCCCCGCAGAGGGAGGAGGG - Intronic
1176131645 20:63498966-63498988 CCTGGGGGGCAGAGGGTGGCCGG - Intronic
1176243143 20:64084223-64084245 CCCGCCCTGCGGAGGGAGGAGGG + Exonic
1176261701 20:64185306-64185328 CCTGTGCTGGAGACGGAGGAGGG + Intronic
1176267318 20:64216980-64217002 CCTGGGCTGCAGATTGGGGTTGG + Intronic
1176310128 21:5145049-5145071 GCTGGACTCCAGTGGGAGGAGGG - Intronic
1178352225 21:31880410-31880432 CTGTGGCTGCAGAGGGAGCATGG - Intronic
1178442666 21:32611822-32611844 AATGGGCTGGGGAGGGAGGAGGG - Intronic
1179086588 21:38223825-38223847 GGTGGGAAGCAGAGGGAGGATGG - Intronic
1179121177 21:38547292-38547314 ATTGGGCTGGAGAGGGAAGAAGG + Intronic
1179521120 21:41945649-41945671 CCTCACCTGCAGAGGGAGGGAGG + Intronic
1179846928 21:44116987-44117009 GCTGGACTCCAGTGGGAGGAGGG + Intronic
1180081214 21:45488662-45488684 CCTGGGCTTCGGAGAGAGAACGG - Intronic
1180244568 21:46538466-46538488 CCCGAGCTGCAGAGAGAGGATGG - Exonic
1180339552 22:11606674-11606696 GCTGGGCTGGAGCGGGGGGAAGG + Intergenic
1180592651 22:16954313-16954335 ACGGGGCTGCAGTGGGAGGAGGG + Intergenic
1180698323 22:17768424-17768446 CCTGGGCAGGGGAGGGAGGCAGG - Intronic
1181086105 22:20440113-20440135 TCTGGTCTGCAGGGGCAGGAAGG - Intronic
1181531711 22:23521056-23521078 CCTGGCCTGCCGAGCGAGGCGGG - Intergenic
1181545439 22:23599688-23599710 GCTGGAGGGCAGAGGGAGGAAGG - Intergenic
1181688387 22:24544392-24544414 GCTGGGGTGCAGTAGGAGGATGG - Intronic
1181814871 22:25430211-25430233 GCTGGAGGGCAGAGGGAGGAAGG + Intergenic
1181851832 22:25754971-25754993 CCTGGGCTGGAGAGGAAGGCGGG + Intronic
1182504692 22:30773368-30773390 CCTGGGCTGGGGAGTCAGGAGGG - Intronic
1182676820 22:32045530-32045552 TCTGGGCTGCACAGGCAGAATGG + Intronic
1183199535 22:36376344-36376366 CCTGGGAGGAGGAGGGAGGATGG - Intronic
1183230471 22:36578832-36578854 CCTGTGCTGGAGGGGGTGGATGG + Intronic
1183408109 22:37640216-37640238 GCTGGGCCGGGGAGGGAGGAGGG + Intronic
1183453885 22:37911072-37911094 CCTGGAGTGGGGAGGGAGGAGGG + Intronic
1183579494 22:38715424-38715446 CTGGGCCTGCAGAAGGAGGAAGG - Intronic
1183689201 22:39378788-39378810 CCTGGGCTGCAGAGGGAGGATGG - Intronic
1183710199 22:39498841-39498863 CCTTAGCTGCAGGGGGAGCAGGG - Intergenic
1183720852 22:39560496-39560518 TCTGGGCTGCAGGGAGAGCAGGG + Intergenic
1183754422 22:39746904-39746926 CATGGGTTGCAGAGGTAGGTGGG + Intronic
1183815029 22:40292654-40292676 CCTGGGCTGCAGAGGAATCACGG - Intronic
1184044707 22:41965647-41965669 CCTGGGTCCCAGAGGGAAGAGGG + Intergenic
1184125607 22:42484487-42484509 CCTGGACTTCACAGAGAGGATGG + Intergenic
1184235124 22:43179230-43179252 GCAGGCCTGCAGAGGGAGGGAGG + Intronic
1184247265 22:43241987-43242009 CCTGTGCTGTAGAGGAGGGATGG - Intronic
1184514407 22:44953093-44953115 CCTGGGCCTCAGAGAGAGGAAGG - Intronic
1184567461 22:45300686-45300708 CCATGGCTGGAGTGGGAGGAAGG - Intergenic
1184712826 22:46263137-46263159 GCTGGGCCGCAGACTGAGGAGGG + Exonic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1184933355 22:47698438-47698460 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1184985546 22:48130868-48130890 ACGGGGCTGCAGAGGGAGGCGGG - Intergenic
1185028792 22:48430871-48430893 CCTGAGCAAGAGAGGGAGGAGGG - Intergenic
1185072906 22:48667037-48667059 CCTGGGATTGAGGGGGAGGAGGG + Intronic
1185100951 22:48840586-48840608 AGTGGGGTGTAGAGGGAGGAGGG - Intronic
1185107690 22:48883579-48883601 CCTGGGAAGGAGAGGGAGTAGGG + Intergenic
1185196184 22:49470825-49470847 CCTGGGCTGCTGTGGCTGGATGG + Intronic
1185243991 22:49763670-49763692 CCAGGGCTGCACAGAGAGGCTGG - Intergenic
1185275854 22:49949970-49949992 CCTTGGCTGGAGAGGGGGGTGGG + Intergenic
1185399964 22:50610599-50610621 GGATGGCTGCAGAGGGAGGAAGG + Intronic
949869102 3:8571646-8571668 CCTGGTCTGCAGCTGGAGAAAGG + Intergenic
950101582 3:10360118-10360140 TGGGGGCTGCAGAGAGAGGAAGG + Exonic
950123868 3:10499717-10499739 CCTGGGCACCAGAGAGAGGCTGG - Intronic
950272528 3:11629720-11629742 CCTGGGCTACAGAGCGAGACGGG + Intronic
950451623 3:13068663-13068685 ATTGGGCCACAGAGGGAGGATGG - Intronic
950550940 3:13665606-13665628 CCTGTGCTGAGGTGGGAGGAAGG - Intergenic
951793715 3:26515487-26515509 CCTGGGCAACAGAGGGAGACGGG - Intergenic
951860294 3:27244616-27244638 GCAGGGTTGCAGAGGGAGAATGG - Intronic
952295272 3:32056696-32056718 CAAGGGTTGCAGAGGGACGAAGG - Intronic
952332455 3:32376764-32376786 GCTGAGCTCCAGAGGGAAGACGG - Intergenic
952881087 3:37986778-37986800 CCTGGGCTGCAGGATGTGGAAGG - Intergenic
953184001 3:40621317-40621339 CTTGGGCAGCAGTGGGAAGAGGG + Intergenic
953274633 3:41482763-41482785 ACTTGTCTGCAGAGAGAGGAAGG - Intronic
953795533 3:45982935-45982957 CCTGGCCTGAGGAGGCAGGAGGG - Intronic
953867325 3:46595569-46595591 CCTGGGCTGCAGAGTGGAGCGGG + Intronic
953921274 3:46953713-46953735 CCCAGGCTGCAGAGGGACGCTGG - Intronic
953928470 3:46994292-46994314 AGTGGGCTGCAGAGGGATGGGGG - Intronic
953978210 3:47398668-47398690 TGGGGGCTGCAGTGGGAGGATGG - Intronic
953979330 3:47405893-47405915 CCTGGGAGGGAGTGGGAGGATGG - Exonic
954125451 3:48525385-48525407 CCTGGGCTGCATAGCTGGGAAGG + Intronic
954163855 3:48740514-48740536 GCAGTTCTGCAGAGGGAGGAAGG + Intergenic
954312432 3:49780547-49780569 TCAGGGCTGCACTGGGAGGAGGG + Intronic
954416530 3:50396033-50396055 GCTGGGCTGGGGAGAGAGGAGGG - Intronic
954439618 3:50514711-50514733 CCAGACCTGCAGAGGGAGGCAGG + Intergenic
954464908 3:50648637-50648659 GCTGGACTGCACAGGGAGGCAGG - Exonic
954592960 3:51799694-51799716 CCTGCAATGCAGAGGGAAGATGG + Intergenic
954683920 3:52360380-52360402 CCTGGGCAACAGTGGGAGGCTGG + Exonic
956378907 3:68645125-68645147 CCTGAGCTGCAGGGGGAGTAAGG - Intergenic
956421906 3:69094360-69094382 CCCTGGCTGCAGAGGCAGGCAGG + Intronic
956793952 3:72701579-72701601 CCAAGGCTGCAGAAGGAGGCTGG - Intergenic
957293789 3:78310639-78310661 CCTGGGCAACAGGGTGAGGAAGG + Intergenic
959041014 3:101423708-101423730 GCTAGGCTGAAGAGGGAGGAAGG + Intronic
959085627 3:101849107-101849129 CTGGGCCTGCAGAGGGAGGCGGG - Intronic
959574632 3:107921311-107921333 CCCCGGGTGCAGAGGCAGGATGG - Intergenic
960440217 3:117677753-117677775 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
960950868 3:122997663-122997685 TCTTTGCTGCAGAGGGAGGGAGG - Intronic
961082205 3:124035814-124035836 ACTGGGCTGCCCAAGGAGGAGGG - Intergenic
961144114 3:124579956-124579978 CATGGTCTCCAAAGGGAGGAAGG + Intronic
961328298 3:126124523-126124545 GCTGGGCTGCTGGGAGAGGAAGG - Intronic
961597718 3:128032124-128032146 GCTGGGGTGCAGAGTGAGGCAGG - Intergenic
961672816 3:128547384-128547406 CCTGTACTGCAGAGGCTGGAAGG - Intergenic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961987927 3:131157698-131157720 GCTGGGCTGAAGGGGGAGGAAGG + Intronic
962201115 3:133401855-133401877 CCTGGGATGAAGTGGGAGGCAGG - Intronic
962509782 3:136086454-136086476 CCTGGGCGACAGAGCGAGAAGGG + Intronic
962867771 3:139461837-139461859 CCTGGCAGGCAGAGGGAAGAGGG - Intronic
963226612 3:142868950-142868972 CCTGGATTCCAAAGGGAGGAGGG - Intronic
963702998 3:148649953-148649975 CCTGGCCTGCAGAGGAATCAGGG + Intergenic
963918851 3:150886726-150886748 CCAGGGAAGCAGAGGGAGGAGGG - Intronic
964636203 3:158860425-158860447 CTTGGGCACCAGTGGGAGGAAGG + Intergenic
965710063 3:171548295-171548317 CCTGGGCAACAGAGGGAGAATGG - Intergenic
966504049 3:180679340-180679362 GCTGAGCTGCACTGGGAGGATGG - Exonic
966905091 3:184516839-184516861 ACTGGTGGGCAGAGGGAGGAAGG + Intronic
967106083 3:186256089-186256111 GCTGATCTGCAGAGGGTGGATGG - Intronic
967884058 3:194321491-194321513 CCTGGGATGCAGAGGTTGCAGGG + Intergenic
968064902 3:195753225-195753247 CCAGAGCTGCAGAGTGAGTAGGG + Exonic
968264262 3:197350497-197350519 CAGGGGCTGGGGAGGGAGGAAGG - Intergenic
968404022 4:323858-323880 CCTGGGAGGCTGAGGCAGGAGGG + Intergenic
968679359 4:1905952-1905974 CCCGGGCTGCAGAGGCTTGAAGG - Intronic
968699067 4:2046309-2046331 ACAGGGCTGCAGAGTGAGGCCGG - Intergenic
968867202 4:3220825-3220847 CCTGCGCTGCTCAGGTAGGAGGG - Intronic
969131180 4:4992130-4992152 CCTGGGCGACAGAGCGAGGCTGG - Intergenic
969263596 4:6049593-6049615 CCTGGCCTGTTGAGTGAGGAGGG - Intronic
969365133 4:6689910-6689932 GATGGGCTGGAGGGGGAGGAGGG - Intergenic
969448855 4:7261501-7261523 TCTGGGCTGGAGAGAAAGGAAGG - Intronic
970263076 4:14250182-14250204 CCAGGGCTGGTGAGGTAGGAAGG + Intergenic
970376498 4:15463010-15463032 ACTGTGATGCAGAGAGAGGATGG + Intergenic
970464090 4:16306016-16306038 CCTGGGCGACAGAGGGAGACTGG - Intergenic
971022174 4:22548037-22548059 CCTGGGCAGCACAGGGATGATGG - Intergenic
971026526 4:22594216-22594238 CCTGTTCTGGAGAGGGATGAAGG - Intergenic
971425094 4:26508087-26508109 CTTGGGATGCTGAGGAAGGAGGG - Intergenic
972032991 4:34486081-34486103 CTTGGGAAGCAGAGGCAGGAGGG - Intergenic
972446615 4:39150415-39150437 CAGGGGATGGAGAGGGAGGAAGG + Intergenic
972775800 4:42239399-42239421 CCTGTGCTGGAGAGAGGGGAGGG - Intergenic
972780478 4:42282895-42282917 CCTGGGCTGGAAGGGGAGGAAGG - Intergenic
973863270 4:55086792-55086814 CCTGGGCTGCAGGGAGGGGCAGG - Intronic
973906867 4:55540727-55540749 CGTGGAGTGGAGAGGGAGGAAGG + Intronic
973971461 4:56217708-56217730 CCTGAATTGCAAAGGGAGGAAGG + Intronic
976412750 4:84735381-84735403 CCTTAGCTGCAGAGGGCCGACGG + Intronic
977245159 4:94622694-94622716 CCTGGGCGACAGAGTGAGGGAGG - Intronic
978348575 4:107797674-107797696 CGTAGGCTTCAGAGGGAGCATGG + Intergenic
980878509 4:138686261-138686283 CCTGGAAGGCACAGGGAGGACGG + Intergenic
981025800 4:140076056-140076078 CCTGGGCAACATAGGGAGGCTGG - Intronic
981088279 4:140706120-140706142 CCCGGCCTGCAGAGGGCTGACGG - Intronic
981244408 4:142517110-142517132 CCTGGTATGCAGAGGGTGGAAGG - Intronic
981520208 4:145652975-145652997 CCTGGGAGGCTGAGGCAGGAGGG - Intronic
981822507 4:148902042-148902064 CCTGGGCTGAGGAGGGAAAAAGG + Intergenic
982086507 4:151841618-151841640 GCTGGGCTGCAGTGGGGAGAGGG - Intergenic
984470982 4:180173160-180173182 CCTGTTCTGCAGACGGAGAATGG + Intergenic
984983466 4:185304726-185304748 GCAGGGCTGAAGTGGGAGGATGG - Intronic
985010095 4:185573545-185573567 ACCTGGCTGGAGAGGGAGGAAGG + Intergenic
985481267 5:112303-112325 TCTGGCCTGCAGTGGGAGAAGGG - Intergenic
985563696 5:604646-604668 CATGGGGTGCAGGGGCAGGAGGG + Intergenic
985726507 5:1518729-1518751 CCTGTGTTCCAGTGGGAGGAAGG + Intronic
985743659 5:1634420-1634442 CGTGGGCTGAGGCGGGAGGATGG + Intergenic
985780205 5:1866633-1866655 CCTGGCCTGTGGGGGGAGGAGGG - Intergenic
985819032 5:2147526-2147548 CCTGGGAGGCAGAGGTAGCAGGG - Intergenic
985851270 5:2390632-2390654 CCTGGGCCACAGGGGGAGGAAGG + Intergenic
986174053 5:5336963-5336985 CATGGGCAGCACAGGGAGGAGGG + Intergenic
986210757 5:5669649-5669671 CTGGGGCTGCACAGGGAGGTAGG - Intergenic
986221994 5:5776354-5776376 CCTGGGATGCAGGAGGAGGGAGG + Intergenic
986299304 5:6465955-6465977 CCTGGGCAGCAGAGGGAGACAGG - Intronic
986892077 5:12320951-12320973 GCTGGGCTGAAGAGGGAGGAAGG - Intergenic
987345352 5:16974029-16974051 CCGGGGCTGAGGTGGGAGGATGG - Intergenic
988875691 5:35443719-35443741 CCTGGGCTCAAGAGGGAGACTGG - Intergenic
988918613 5:35920629-35920651 CCAGGGTGGAAGAGGGAGGAAGG - Intronic
989323539 5:40164860-40164882 CTGGGGTTGAAGAGGGAGGAAGG + Intergenic
989503536 5:42198387-42198409 CCTGGGAGGCTGAGGTAGGAGGG - Intergenic
989578529 5:43010772-43010794 CCTGTGCAGCAGAAGGTGGATGG + Intergenic
991085726 5:62646916-62646938 GCTGTGTGGCAGAGGGAGGAAGG - Intergenic
991249537 5:64544564-64544586 CCTGGGAAGCTGAGGCAGGAGGG + Intronic
992125152 5:73632201-73632223 ACTGGGGTACAGGGGGAGGAGGG + Intronic
992161560 5:74008864-74008886 CCTGTGCTTCAAGGGGAGGAAGG + Intergenic
992436901 5:76763177-76763199 CATGAGCTGCAGAGGGGAGAAGG - Intergenic
992792754 5:80228207-80228229 CCTGGGCAGCAGAGTGAGTGAGG + Intronic
993485257 5:88475983-88476005 CCTGGTCTGTAGGGGGAGCATGG + Intergenic
993745847 5:91596017-91596039 CCTGTGCTTCAGAGTGAGGTGGG + Intergenic
995046268 5:107652148-107652170 CATGGGCTGAAGAGGTAGGTTGG - Intronic
996118410 5:119644321-119644343 CCTGGGCTGAGGATGGAGGAAGG - Intergenic
996903804 5:128575091-128575113 CCTGGATTCAAGAGGGAGGAGGG - Intronic
997283557 5:132663121-132663143 CCTGGGCTGGAGAGGGCGTGGGG + Intergenic
997371718 5:133365781-133365803 CATGTGCTGAAGAGGGAGAATGG + Intronic
997598338 5:135122164-135122186 CATGGCCTGTAGAGTGAGGATGG + Intronic
997658699 5:135574063-135574085 TCTGGGCAGCAGAGGGAGTGGGG + Intronic
997663576 5:135608740-135608762 CCTTGGGAGAAGAGGGAGGATGG - Intergenic
997824002 5:137090402-137090424 TGTGATCTGCAGAGGGAGGAAGG - Intronic
998084245 5:139303624-139303646 CTTGGGCTGAGGTGGGAGGATGG + Intronic
998453135 5:142250005-142250027 CCTGGGGTGAGGTGGGAGGAAGG + Intergenic
998536069 5:142932030-142932052 CCTGGCCTGCAGAGAAAGGAGGG - Exonic
998797988 5:145839186-145839208 ACTGAGCTGCAGGGGCAGGAAGG - Intergenic
999228724 5:150048831-150048853 CCTGGGCTAGGGAGGGAGGCTGG + Intronic
999253251 5:150195107-150195129 CCTGGGGATGAGAGGGAGGAAGG - Intronic
999275238 5:150325654-150325676 CTTGGTGTGCAGAGGGTGGAGGG - Intronic
1000115726 5:158151735-158151757 CCTGGGCAACAGAGCGAGGAAGG - Intergenic
1000245097 5:159442504-159442526 CCAGGGATGTAGAGGGTGGAAGG - Intergenic
1001283960 5:170409016-170409038 TCAGGGCTGCAGAGGCGGGAGGG + Intronic
1001543294 5:172554152-172554174 CCTGGGCTGCTGAGGGCTCAGGG - Intergenic
1001599037 5:172917008-172917030 GCTGGGCTGGAGAGGGTGGCAGG + Intronic
1001741743 5:174058578-174058600 CCTGGAGTGGAGACGGAGGAGGG + Intronic
1001857112 5:175022561-175022583 CTGGGGCTGCAGGGGGAGGGAGG + Intergenic
1002083332 5:176750454-176750476 CCAGGGCTGCTCATGGAGGATGG + Intergenic
1002086038 5:176776235-176776257 CCTGGGCTGCGCTGGGAGGGCGG + Intergenic
1002098432 5:176845529-176845551 CCTGGGCTGCAGAGGGTCTGTGG - Intronic
1002407268 5:179044898-179044920 CCTAAACTCCAGAGGGAGGAGGG + Intergenic
1002762225 6:210905-210927 CCAGGGCTGCTGAGGGGAGAGGG - Intergenic
1003190608 6:3871153-3871175 CCTGGGCAACAGAGGGAGACGGG - Intergenic
1003520493 6:6854545-6854567 AGTGGTCTGCAGAGAGAGGAAGG - Intergenic
1003550934 6:7101461-7101483 CTGGAGCAGCAGAGGGAGGAGGG - Intergenic
1003868479 6:10383618-10383640 CCTAGGCTGCAGAGGGCGGCGGG - Intergenic
1003869594 6:10391164-10391186 CTTGGGCGGCAGGGAGAGGAAGG - Intergenic
1003874867 6:10426286-10426308 CTTGGGCTGCGGCGGGAGGCGGG + Intergenic
1003890069 6:10556143-10556165 ACGGGGAGGCAGAGGGAGGAGGG + Intronic
1004188643 6:13445149-13445171 CCGAGGCTGAACAGGGAGGAGGG + Intronic
1004475602 6:15968322-15968344 CTGGGGCTGCAGAAGGAAGATGG + Intergenic
1004630016 6:17412175-17412197 ACTGGGCTACTGAGGCAGGAGGG - Intronic
1005502502 6:26442122-26442144 CAAGGTCTGCAGAGGGAGGTGGG - Intronic
1005743870 6:28817908-28817930 CCTGGGCAACAGAGAGAGAAGGG + Intergenic
1005887628 6:30108794-30108816 TCTGTGCTGAAGAAGGAGGAAGG + Intronic
1005923152 6:30418280-30418302 CCTGGAGTGCAGAGGGTGGGTGG + Intergenic
1005982051 6:30844122-30844144 CCTGGGCAGAAGAGCCAGGAAGG - Intergenic
1006090473 6:31625815-31625837 CCTGGGGTCCATAGGGCGGAGGG - Exonic
1006310818 6:33257905-33257927 CTTGGGAGGCTGAGGGAGGAGGG + Intronic
1006362176 6:33592854-33592876 CCTGGGCTGCCGAGGAGGAAAGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1006920249 6:37623185-37623207 CCTGGGGTGTAGAGGCAGGAAGG + Intergenic
1007253150 6:40510143-40510165 ACTGTGCTGCACAGGTAGGAGGG + Intronic
1007396528 6:41581134-41581156 CCTGGGCTGCAGCTGCAGCAAGG - Intronic
1007464402 6:42041856-42041878 TTTGGGCTCCAGATGGAGGAGGG - Intronic
1007727739 6:43926869-43926891 CTCAGGCGGCAGAGGGAGGAGGG - Intergenic
1008413191 6:51207199-51207221 TCTTGGCTGCTGTGGGAGGAAGG - Intergenic
1009748890 6:67857171-67857193 ACTGGGCTGGAGAGGAAAGAAGG + Intergenic
1010083291 6:71887430-71887452 ACTGGGGTGCAGAGGAGGGATGG + Intronic
1011289884 6:85765911-85765933 CCTGGGAGGCAGAGGTAGCAAGG + Intergenic
1011535258 6:88369808-88369830 CCTGAACCACAGAGGGAGGAGGG + Intergenic
1011629691 6:89311711-89311733 CAGGGCCTGCACAGGGAGGAGGG - Intronic
1012278516 6:97301486-97301508 CCTGAGCGGCAGTGGAAGGAGGG - Intergenic
1012497677 6:99852582-99852604 TCTGGGAGGCAGAGAGAGGAAGG - Intergenic
1012566064 6:100653610-100653632 CCTGGGCGACAGAGCGAGGCTGG + Intronic
1013442968 6:110190432-110190454 GCTGGGATGCAAAGAGAGGAGGG + Intronic
1013601574 6:111710112-111710134 GCTGGGCGGGAGAGGGTGGAGGG - Intronic
1013607347 6:111762459-111762481 CCTGAACTCCAAAGGGAGGAGGG - Intronic
1013652519 6:112210037-112210059 CATGGCCTGCAGTGGGAGGTGGG - Intronic
1013819299 6:114135594-114135616 CCCTGGGTGGAGAGGGAGGATGG - Intronic
1015497280 6:133894678-133894700 CCTGGGCTGAAGCTGGAGCAGGG - Exonic
1015993632 6:138975116-138975138 TCTGGGCAGCAGAGTTAGGAGGG - Intronic
1017293661 6:152770035-152770057 CCTGGGCTGCAGAGGGCCCTCGG - Intergenic
1017294287 6:152776152-152776174 CAGGGGGTGCAGTGGGAGGAGGG + Intergenic
1017719674 6:157235967-157235989 CCTGGGGTGCACACGGAGGAGGG + Intergenic
1017775025 6:157673765-157673787 CCGGGGCTGCAGAGGGCGGCTGG + Exonic
1017824105 6:158069034-158069056 CCTGGGGTGCAGGGGAAGGGCGG + Intronic
1017842290 6:158232036-158232058 CCTGGGCCGGGGAGGGAGGGCGG + Intergenic
1017901093 6:158719024-158719046 ACTGGGCTGGAGCGGGAGGCAGG - Intronic
1017981320 6:159402796-159402818 CCTGGGCTGCAGAGGAAGGATGG + Intergenic
1018471362 6:164101175-164101197 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471369 6:164101195-164101217 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018471391 6:164101257-164101279 GGGGGGCTGCAGATGGAGGAGGG - Intergenic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1018716942 6:166540669-166540691 CCTGTGCTGTGAAGGGAGGAAGG - Intronic
1018803961 6:167244349-167244371 GCAGGGCTGCTGACGGAGGAGGG + Intergenic
1018844703 6:167547495-167547517 GATGGGGTGAAGAGGGAGGAGGG - Intergenic
1018948881 6:168365469-168365491 CTTGGCCTGCAGAGAGGGGAGGG + Intergenic
1019109035 6:169694993-169695015 CCCGGCCAGCAGAGGGAGAAGGG + Intronic
1019122124 6:169811926-169811948 AGTGGGTTGGAGAGGGAGGAAGG - Intergenic
1019430767 7:997908-997930 CTCGGGCCGCAGTGGGAGGACGG - Intronic
1019443861 7:1060935-1060957 GCTGGGCTGCAGGGGTAGGAGGG - Intronic
1019531083 7:1503872-1503894 CCCGGGCTGCAGAGCGAGGAGGG + Intronic
1019621406 7:1994228-1994250 CCAGGGCAGCACAGGGACGATGG + Intronic
1019626556 7:2018820-2018842 CTTGGGCTGGAGGGGGCGGAGGG - Intronic
1019633038 7:2059634-2059656 GCGGGGCTGGAGAGGGAGCATGG + Intronic
1019709646 7:2512342-2512364 AACGGGCTGCAGAGAGAGGACGG + Intergenic
1021403597 7:20238069-20238091 CCTGGTCTGAAAAGGGAGGAGGG + Intergenic
1021808784 7:24382291-24382313 CCTGGTCTGCTGGGTGAGGAGGG + Intergenic
1022032841 7:26507847-26507869 CCTGAGCAGCAGGGGGAAGAAGG + Intergenic
1022485391 7:30773662-30773684 GCAGGGTGGCAGAGGGAGGATGG - Intronic
1022531208 7:31068040-31068062 TCTGGGCTTCAGAGGGCAGATGG + Intronic
1022732357 7:33041302-33041324 CCAGGGCTGGAGGAGGAGGATGG + Intronic
1022967610 7:35487966-35487988 ACTGGGCTGCAGAACCAGGAAGG - Intergenic
1023731208 7:43194108-43194130 CCTGAACTCCAAAGGGAGGAGGG + Intronic
1023841704 7:44101916-44101938 CCTGGGCTACAGTGGGGGGCTGG - Intergenic
1023844972 7:44115472-44115494 ACTGGCCTGCAATGGGAGGAGGG - Intronic
1023967010 7:44967969-44967991 CCAGGGCTGGTGAGGGAGCAGGG + Intronic
1024034511 7:45495806-45495828 CCTGAATTCCAGAGGGAGGAGGG + Intergenic
1024059089 7:45685145-45685167 CCAGGGCTGCAGAGACAGGGAGG + Intronic
1024242247 7:47444640-47444662 CCTCAGCTGCAGAGTGAGAAGGG + Intronic
1024250317 7:47501386-47501408 CCTGGGCTGTTGGTGGAGGATGG - Intronic
1024532791 7:50407194-50407216 CCAGTGCTGCAGAGGCAGGATGG + Intergenic
1024984435 7:55183004-55183026 CCTGGCCTCCAGAGCCAGGAGGG - Intronic
1025212220 7:57026270-57026292 GGTGAGCTGCAGAGGGAGGATGG + Intergenic
1025237014 7:57241365-57241387 CCTGGTCTGCACAGGGAGCTGGG + Intergenic
1025659734 7:63550558-63550580 GGTGAGCTGCAGAGGGAGGATGG - Intergenic
1026470117 7:70687925-70687947 CCTGGGCTGAACAGTGTGGAAGG + Intronic
1026818190 7:73528790-73528812 CCTGGGCGGCAGAGGTTGCAAGG - Intergenic
1026911255 7:74093159-74093181 CCTGAGCCCCTGAGGGAGGATGG + Intronic
1026966696 7:74444693-74444715 CTTGGGGGGCTGAGGGAGGATGG - Intergenic
1027234008 7:76287161-76287183 CCCGGGCTCCAGTGGGGGGAGGG + Exonic
1027539178 7:79446159-79446181 CCTGTTGTGCAGTGGGAGGAGGG + Intronic
1028237038 7:88374522-88374544 CCTGTACTGCAGAGGCTGGAAGG + Intergenic
1028424706 7:90673422-90673444 CCTGGGCAACAGAGGGAGGGAGG - Intronic
1028990485 7:97044153-97044175 CCTGGGGTGCAGCAGGATGAAGG + Intergenic
1029243577 7:99182221-99182243 CCTGGGCGACAGAGTGAGGGGGG - Intronic
1029396000 7:100309008-100309030 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396223 7:100310394-100310416 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396449 7:100311784-100311806 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396673 7:100313174-100313196 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029396898 7:100314566-100314588 CCTTGGCTGCAAAAGGAAGAGGG + Exonic
1029457610 7:100679011-100679033 CCAGGGCAGCAGAAGGATGAGGG - Exonic
1029514193 7:101015821-101015843 CCGGGGCTGCAGCGGCAGGTAGG - Intronic
1029587875 7:101486968-101486990 CCAGGGCTGGAGGGGGAGGAAGG + Intronic
1029675399 7:102065036-102065058 GGTGAGCTGCAGAGGGAGGATGG + Intronic
1030788591 7:113694910-113694932 CCTGGGATGCAGAAGAGGGAAGG + Intergenic
1031427309 7:121621363-121621385 CCAGCTGTGCAGAGGGAGGACGG - Intergenic
1031640744 7:124161247-124161269 CCTGGGTTGCAGAGGCAGAAGGG - Intergenic
1032068992 7:128792248-128792270 GCTGGGGTGCAGAGGAAAGAAGG - Exonic
1032096562 7:128941128-128941150 TCTGGGCTGGAGAGGGAGTTGGG + Intronic
1032231684 7:130079965-130079987 CCTGGGCGACAGAGGGAGGGAGG - Intronic
1032345175 7:131110069-131110091 CCGGAGCTGGAGGGGGAGGAGGG + Intergenic
1033041689 7:137925093-137925115 CCTGGGGTTCAGGTGGAGGATGG + Intronic
1033162244 7:139007942-139007964 CCTGAGTTCCAAAGGGAGGAGGG - Intergenic
1033582702 7:142751619-142751641 CATGGGCAGCAGAGGGATGTGGG - Intronic
1033737797 7:144241032-144241054 CCAGGGCTGCAGTGGAAGGAGGG + Intergenic
1033745258 7:144309925-144309947 CCAGGGCTGCAGTGGAAGGAGGG - Intergenic
1033860202 7:145615279-145615301 CCTGTGCTGGATGGGGAGGAAGG - Intergenic
1033974964 7:147089850-147089872 CCTTTGGTGCAGAGTGAGGACGG - Intronic
1034060136 7:148079810-148079832 CCTGGATTCCAAAGGGAGGAGGG + Intronic
1034109866 7:148526531-148526553 CCTGAACTCCAAAGGGAGGAAGG - Intergenic
1034265448 7:149778408-149778430 GCTGGGCTGCAGGGTGAGGTGGG + Intergenic
1034270005 7:149798808-149798830 CAGGGGCTGGAGAGGAAGGAGGG + Intergenic
1034279947 7:149846286-149846308 GCTTGGCTGGAGAGGGAGCATGG + Intronic
1034306586 7:150048807-150048829 GCTGGGCTGTGGAGGGAGGGCGG - Intergenic
1034401170 7:150862587-150862609 CCTCAGCTCCAGAGGGAGGGAGG - Intergenic
1034418956 7:150979130-150979152 CCCGGGCTGCCGGGGGAGGGCGG - Intergenic
1034435140 7:151059792-151059814 CCAGGGCCGCAGAGGGAGGAAGG + Intronic
1034784217 7:153910466-153910488 CCTGGGCTGGAGAGGCAGCCAGG - Intronic
1034800261 7:154051836-154051858 GCTGGGCTGTGGAGGGAGGGCGG + Intronic
1034815888 7:154171607-154171629 CCTGGGCTGCAGGTGGGAGATGG - Intronic
1034949092 7:155284960-155284982 CCAGGGCTGCAGACCAAGGAAGG + Intergenic
1035018599 7:155787517-155787539 CCTGGCCTGCAGCGGGCGGGCGG - Intergenic
1035071577 7:156148779-156148801 TCCTGGCTGGAGAGGGAGGAGGG - Intergenic
1035245843 7:157561514-157561536 TCAGGGCCCCAGAGGGAGGATGG - Intronic
1035337815 7:158141360-158141382 CCTGCGCTGTGGAGAGAGGACGG - Intronic
1035618160 8:1017706-1017728 CCAGGGCTGTAGAAGCAGGACGG + Intergenic
1035922693 8:3694619-3694641 CCTGGGCATGAGAGGGAGGCTGG + Intronic
1036111821 8:5911135-5911157 CATGGAGTGGAGAGGGAGGAAGG + Intergenic
1036601600 8:10265762-10265784 CCAGGGCTGCGGGGTGAGGAAGG - Intronic
1036656390 8:10679915-10679937 CCTCAGCTGGAGAGTGAGGAAGG + Intronic
1036661848 8:10714166-10714188 CCAGGGCAGCTGAGGCAGGATGG + Intergenic
1037529041 8:19756733-19756755 GCTGGGATGGAGAGGGTGGAGGG - Intronic
1037579554 8:20236475-20236497 TCTGGGCTGGTGAGGGAAGAGGG - Intergenic
1037882635 8:22580362-22580384 CCTGGGCTGAAGACTAAGGAAGG + Intronic
1037915745 8:22772263-22772285 TCTGGGCAGGAGAGGGAGCAGGG + Intronic
1037988053 8:23301982-23302004 CCAGCCCTGCAGGGGGAGGAGGG - Intronic
1038058640 8:23886948-23886970 CCAGAGCTACAGGGGGAGGAAGG + Intergenic
1038421355 8:27436040-27436062 CCTAGCCTTCAGAGGGAGCAGGG + Intronic
1038620581 8:29139026-29139048 CCTGGGGTGCTAAGGGAGGGGGG + Intronic
1038625547 8:29189742-29189764 ACTGGGCTGGAGAGACAGGATGG - Intronic
1039410414 8:37350178-37350200 GCTGGGATGCAGAGAGAGGTGGG - Intergenic
1039965101 8:42278278-42278300 CCTGGGTGGCTGAGGGTGGACGG + Intronic
1040587608 8:48757919-48757941 CAGGGGCTGCTGCGGGAGGAGGG + Intergenic
1040832391 8:51691814-51691836 CCCGGCCAGCAGAGGGAGGAAGG + Intronic
1041113154 8:54506689-54506711 CCTGGACAGCAGAGGCAGGGCGG - Intergenic
1042125425 8:65533493-65533515 CATGGCCTGCAAAAGGAGGAAGG + Intergenic
1042207174 8:66340978-66341000 GATATGCTGCAGAGGGAGGAAGG - Intergenic
1044776466 8:95693878-95693900 GGCGGACTGCAGAGGGAGGAGGG - Intergenic
1044931852 8:97259216-97259238 ACTGGGGTTCAGAGGCAGGAGGG + Intergenic
1045108979 8:98921440-98921462 CATGGAGTGCTGAGGGAGGAAGG + Intronic
1045232854 8:100321741-100321763 CATGGGCTGCAGATGGATGTTGG + Intronic
1045290827 8:100831260-100831282 CCTGAACTCCAAAGGGAGGAGGG + Intergenic
1045582620 8:103498531-103498553 CCTGGGGAACAGAGGGAGGAGGG + Intergenic
1045952429 8:107866406-107866428 CCTGGGCTCCAGCTGGAGAATGG + Intergenic
1046454597 8:114441188-114441210 CCTGGGCTGGAGCGAGAGCAGGG + Intergenic
1046654865 8:116882307-116882329 CTTGGGAGGCAGAGGTAGGAGGG - Intergenic
1046932405 8:119854992-119855014 CTGGGGCTGCACAGGGTGGAGGG + Intronic
1047343915 8:124009209-124009231 GCTGGAGTGCAGAAGGAGGATGG - Intronic
1048838960 8:138547841-138547863 GCTTGGCTGGAGAGGGAGGAAGG + Intergenic
1049259072 8:141629237-141629259 CCTGGGATGCTGGGGGATGATGG + Intergenic
1049322855 8:142006208-142006230 CCTGGGCTTGAGAAGAAGGAAGG - Intergenic
1049345737 8:142137654-142137676 GCTGGGCTTCAGAGGCAGGCTGG + Intergenic
1049376324 8:142291049-142291071 CCTGGGCAGGAGAGGTTGGAGGG - Intronic
1049408137 8:142460733-142460755 TCTGGCCTGGAGAGGGAGGAGGG - Intronic
1049424342 8:142531448-142531470 CGTGGGGTGCACAGGGAGCAGGG + Intronic
1049605518 8:143527412-143527434 CCTGGGCTGCGCAGGCAGGGTGG - Intronic
1049637103 8:143694922-143694944 CATGGGGTGCAGAGCCAGGAAGG - Exonic
1049672950 8:143877859-143877881 CGTGGGAGGCAGAGGCAGGAAGG - Intronic
1049741410 8:144242806-144242828 CCTGGACGGCAGTGGGAAGAAGG + Intronic
1049782484 8:144435295-144435317 GCTGGGCTGCAGGGAGAGGAGGG - Intronic
1049822704 8:144645819-144645841 CCAGGGCTGCAGGGGGAGCTGGG + Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050144621 9:2553535-2553557 CCAGGGTTTCAGAGGGAGGCAGG + Intergenic
1051350152 9:16191414-16191436 ACTTGGGAGCAGAGGGAGGAAGG + Intergenic
1051388625 9:16539500-16539522 CCTGGGCAACAGAGGGAGAGAGG + Intronic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1052978428 9:34429407-34429429 CCTGAGCTGGTGAGTGAGGAGGG - Intronic
1053192837 9:36087890-36087912 CGAGGCCTGTAGAGGGAGGAGGG - Exonic
1053394628 9:37761974-37761996 CCTGTGCTGCAGGGGCAAGAAGG + Exonic
1053543071 9:38994334-38994356 GTTGGGCTGAAGGGGGAGGAAGG - Intergenic
1053662144 9:40291471-40291493 CTGGGGATGCAGAGAGAGGAGGG - Intronic
1053912590 9:42921639-42921661 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054374270 9:64437712-64437734 CTGGGGATGCAGAGAGAGGAGGG - Intergenic
1054522466 9:66084813-66084835 CTGGGGATGCAGAGAGAGGAGGG + Intergenic
1055261071 9:74434398-74434420 CCTCGGCTGCAGCTGGAGGCTGG - Intergenic
1056365148 9:85897418-85897440 GCTGGGCTGCAGTCTGAGGAGGG - Intergenic
1057041680 9:91852948-91852970 CATGCGCTGAAGAGGGAGCAAGG - Intronic
1057219224 9:93247085-93247107 CCCGAGTTGCAGATGGAGGAAGG - Intronic
1057294012 9:93824973-93824995 GCTGGGCTGCAGAGGGCTGTTGG - Intergenic
1057763225 9:97892875-97892897 CATGGGGTGCTGAGGGAGAAAGG - Intergenic
1057952639 9:99382115-99382137 CCTGGGTTGGGGAGGCAGGATGG - Intergenic
1058442400 9:105021649-105021671 CCAGGGCTGAAGGCGGAGGATGG + Intergenic
1058717868 9:107738660-107738682 CCCTGCCTGCCGAGGGAGGATGG + Intergenic
1059341918 9:113602154-113602176 CCTGCGGGGCAGAGGGAGGGAGG + Intergenic
1059391601 9:114002682-114002704 CGTGGGCTGCTGAGGGGCGAGGG + Intronic
1059993916 9:119891234-119891256 GAAGGGCTGCAGAGAGAGGACGG - Intergenic
1060059379 9:120445483-120445505 CATGGGTTGCAGAGAGAGAATGG - Intronic
1060344290 9:122803098-122803120 CCTGGGCGTGGGAGGGAGGAAGG - Intronic
1060551029 9:124485521-124485543 CCTGGGCTGGGCTGGGAGGATGG - Intronic
1060994281 9:127867479-127867501 CCTGGACTGCACAGGCAGCAAGG - Exonic
1061248810 9:129414767-129414789 CCTGGGCTGCCGGGCGAGGCGGG + Intergenic
1061253043 9:129437629-129437651 TCTGGGTGGCAGAGGGGGGAAGG + Intergenic
1061334465 9:129922530-129922552 CCTGGGCTTCATAGGGTGGCTGG + Intronic
1061559771 9:131394599-131394621 GCCGGGCTGCAGAGGCCGGAGGG + Intronic
1061966969 9:134020447-134020469 CCTGGGAGGCTGAGGCAGGAGGG - Intergenic
1062243479 9:135551808-135551830 CCTGGGCAGCTTAGGGAGGTGGG + Intergenic
1062252267 9:135604326-135604348 CTTAGGCTGCAGAGTGAGGGTGG - Intergenic
1062318081 9:135978035-135978057 CCAGGGCTGCTGAGGGGGAATGG - Intergenic
1062391649 9:136336288-136336310 CCTGGGCTGCAGTGTCAGCATGG - Intronic
1062447879 9:136603288-136603310 CCTGGGGGGCAGAGGGAGGTTGG + Intergenic
1062452624 9:136621913-136621935 CATCTGCTGCAGAGGAAGGAAGG - Intergenic
1062478998 9:136742909-136742931 CCTTGGCGGCTGAGGGAGGAGGG - Exonic
1062503029 9:136859324-136859346 CCTGGGCTGCAGTGGAGGCACGG + Intronic
1062596766 9:137303025-137303047 CGTGGGCAGCAGAGGGAGGCAGG - Intergenic
1062637707 9:137500296-137500318 CCCAGGCTGCAGAGGTGGGACGG + Intronic
1185448591 X:271334-271356 CCTGGGGCACAGCGGGAGGAAGG + Intergenic
1185734857 X:2488911-2488933 CTTGGGCAGCAGGGGGAAGAGGG + Exonic
1186479020 X:9881716-9881738 TCGGGGAGGCAGAGGGAGGAAGG - Intronic
1186538658 X:10376432-10376454 CCTGGGCAGTAGATGTAGGATGG + Intergenic
1186811922 X:13198672-13198694 CCTGAACTCCAAAGGGAGGAGGG - Intergenic
1186977142 X:14919655-14919677 ACTGAGCTGAAGAGGGAAGAGGG - Exonic
1189243159 X:39541200-39541222 TCTGGGCTGCAGCAGGAGGGTGG - Intergenic
1189795835 X:44645222-44645244 CATGCGCTGCAGGGGCAGGAAGG + Intergenic
1190743506 X:53306335-53306357 CCAGGGGTCCAGAGGGAGGCAGG + Intronic
1190913296 X:54791084-54791106 CCTGGGCAGGAAAGGGAGGATGG + Exonic
1191108052 X:56784378-56784400 CCTGGGCTCCAGAGAGAGAGAGG - Intergenic
1193300266 X:79881098-79881120 GCTGGGCTGAAGGGAGAGGAAGG + Intergenic
1194754542 X:97722983-97723005 GCAGGGCTGCAGTGGGAGGTAGG - Intergenic
1195247106 X:103004730-103004752 TCTGGGCTGCTGAGGGTGGCAGG + Intergenic
1197312087 X:124917194-124917216 GCTGGCCTGCAGAGAGAGGTAGG + Intronic
1197760420 X:130024216-130024238 CCTGGGGTGGTGGGGGAGGAGGG + Intronic
1198069133 X:133130518-133130540 CTGGGGCAGGAGAGGGAGGAGGG + Intergenic
1198165416 X:134050480-134050502 CCTGGGGGGCGGTGGGAGGAAGG - Intergenic
1198249701 X:134868128-134868150 CCTGGGCAGCAGAGTGAGACCGG - Intergenic
1198562980 X:137871405-137871427 CCAGGGATACAGAGAGAGGATGG - Intergenic
1199269394 X:145865049-145865071 CCTGGGCTGAGGATCGAGGAAGG + Intergenic
1199581842 X:149368380-149368402 CTTGGGCTGCTGAGAGAGAAAGG - Intergenic
1200075157 X:153547111-153547133 CCGGGGCAGAAGAGGGAGGTGGG + Intronic
1200276104 X:154734484-154734506 CCAGGGCCTAAGAGGGAGGATGG + Intronic
1201382097 Y:13392058-13392080 CAGGGGCTGAAGAGGGAGGATGG + Intronic