ID: 1183693118

View in Genome Browser
Species Human (GRCh38)
Location 22:39402454-39402476
Sequence GCATTTGCAAGGGTATGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 152
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 139}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183693110_1183693118 14 Left 1183693110 22:39402417-39402439 CCTGATTGGTCTGGGTCAGTGGA 0: 1
1: 0
2: 1
3: 13
4: 117
Right 1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG 0: 1
1: 0
2: 0
3: 12
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183693118 Original CRISPR GCATTTGCAAGGGTATGCTG GGG Intronic
903805809 1:26004986-26005008 GCATTTGCAAAGATATGCAGGGG - Intergenic
904092879 1:27957373-27957395 GCCTGTGCAACGGTAGGCTGTGG + Intronic
906126099 1:43427861-43427883 GCAAGTTCAAGGGTTTGCTGAGG - Intronic
909016308 1:70383565-70383587 GCATCTGTAAAGGTATGCAGAGG - Intronic
909341603 1:74538288-74538310 GGAATTGCAGGGGAATGCTGTGG + Intronic
910844804 1:91594670-91594692 GCCTTTACAAAGGCATGCTGAGG + Intergenic
918397439 1:184129256-184129278 TCATTTTCATGAGTATGCTGAGG + Intergenic
919412752 1:197266508-197266530 GCATAAGTATGGGTATGCTGCGG - Intergenic
920899511 1:210093009-210093031 GTATTTGAAAGGGAATGGTGGGG + Intronic
921524719 1:216202428-216202450 GCATTTGAAAGGGTATGAATAGG + Intronic
924018550 1:239755119-239755141 GCATTGGTAAGGGTATGGTTTGG - Intronic
924596908 1:245454397-245454419 GCATTTGGAAGGGGCTGCTCAGG - Intronic
1062806437 10:423370-423392 GCGTTTCCTAGGGGATGCTGAGG + Intronic
1070652613 10:78248779-78248801 GGTTTTGCAAAGGAATGCTGGGG + Intergenic
1074433092 10:113409942-113409964 CAATATGCAAGGGTTTGCTGGGG - Intergenic
1075155932 10:119975764-119975786 GCATTTGAATGGGTAGACTGAGG - Intergenic
1076675470 10:132145507-132145529 CCATTTGCAAGGATATGAAGTGG + Exonic
1079725888 11:23880113-23880135 GCAATTGCAAGGGGATGCGATGG + Intergenic
1080147068 11:28998936-28998958 GCATTTTTAAGGGTTTGTTGTGG + Intergenic
1086140777 11:83496944-83496966 GCATTTTTAAGGTTATGCTTAGG + Intronic
1089035174 11:115381752-115381774 GAATGTGCAAGGCTATGCTAGGG + Intronic
1091757562 12:3064663-3064685 GTATTTTGAAGGTTATGCTGAGG + Intergenic
1092108014 12:5937717-5937739 GTTGTTGCCAGGGTATGCTGTGG + Intronic
1094091037 12:26650264-26650286 GCAGTTGCCAGGGGATGGTGAGG + Intronic
1095154624 12:38837432-38837454 GCATTTGCTAAGGTATCCAGAGG + Intronic
1095544205 12:43345500-43345522 GTATTTGCAAAGATATGCTTTGG - Intergenic
1096324141 12:50643285-50643307 GTATTAGAAAGCGTATGCTGTGG + Intronic
1098928935 12:76387039-76387061 GCATTTGCAATGTTAGGCAGTGG + Intronic
1100496904 12:95133867-95133889 ATATTTGCAAGGCTATGGTGAGG + Intronic
1103350985 12:120283485-120283507 GTATTTGGAAAGGTATGCCGAGG + Intergenic
1104598327 12:130134777-130134799 GCATCAGCAGGGATATGCTGGGG - Intergenic
1106998971 13:35522146-35522168 GCATTTGCTATAGGATGCTGGGG + Intronic
1107630034 13:42333803-42333825 CCATTGGCCAGGGTATGCAGAGG + Intergenic
1108935175 13:55873691-55873713 GCAATTGCATGGGTAACCTGAGG - Intergenic
1110341650 13:74398644-74398666 GCCTTTTCAAGGGCATGCTCAGG - Intergenic
1110964950 13:81682359-81682381 GAATGTTCAAGGGTATCCTGTGG - Intergenic
1113850998 13:113418029-113418051 GCAATCGCCAGGGTTTGCTGAGG + Intergenic
1114552669 14:23542376-23542398 ACATTTGCATGGATTTGCTGAGG + Intronic
1115328522 14:32168477-32168499 GTATTAGCAAGGGTAAGATGAGG + Intergenic
1118685192 14:68283802-68283824 GCACATGCAAGGGGATGCAGTGG - Intronic
1120481752 14:85057786-85057808 GCAATTGCAAAGGTACACTGTGG - Intergenic
1120860533 14:89251249-89251271 GTACTTGCATGGGTGTGCTGTGG - Intronic
1121863228 14:97338750-97338772 GCTTTTGCAAAGTTATGTTGTGG - Intergenic
1123062830 14:105601969-105601991 GCACTTGCAGGGGGAGGCTGGGG - Intergenic
1124464083 15:29920551-29920573 GCGTTTGGAAGGGAAGGCTGAGG - Intronic
1124636027 15:31365789-31365811 GCATTTGCATGTGGCTGCTGTGG + Intronic
1124674730 15:31674484-31674506 GTAGGTGCAAGGGTATGCAGTGG - Intronic
1129182252 15:73884897-73884919 GCATTGACAAGGGGAGGCTGAGG - Intronic
1129234757 15:74217454-74217476 GCAGTTGCAAGTGAATGATGGGG + Intergenic
1129832609 15:78680653-78680675 GCAGGTGCAAGGGGAGGCTGGGG - Intronic
1130997242 15:88910770-88910792 GCAGCTGGAAGGGTAGGCTGGGG + Intronic
1136169885 16:28482534-28482556 GCCTTTTCCAGGGTCTGCTGTGG - Exonic
1138563775 16:57817685-57817707 GCCTTTGCAGAGGTATGCAGAGG - Intronic
1139545804 16:67649024-67649046 GAAGTTGCAAGGGTAGGGTGGGG - Intronic
1140476907 16:75243682-75243704 GGCTCTGCAAGGGTTTGCTGAGG - Intronic
1141298700 16:82793210-82793232 GCATTTGCAAGGGCAGCATGGGG + Intronic
1143260465 17:5594826-5594848 GCATTTCCAAGGTGGTGCTGAGG - Intronic
1143662187 17:8332349-8332371 GGATAGGCAAGGTTATGCTGTGG - Intergenic
1143894826 17:10127824-10127846 GCATTTCCAAGGAGATGCTTGGG - Intronic
1145432961 17:22994628-22994650 GCATCTGCAAGTGTATGTTTGGG + Intergenic
1145442598 17:23127869-23127891 GCATCTGCAAGTGGATGCTTGGG + Intergenic
1147510815 17:41067495-41067517 GGCTATTCAAGGGTATGCTGAGG - Intergenic
1152089428 17:78238616-78238638 GCATGTGCATGTGTGTGCTGGGG + Intronic
1153785041 18:8526858-8526880 GCATAGGCGAGGCTATGCTGGGG - Intergenic
1156585280 18:38425048-38425070 TCACTTCCAAGGGTATGCTAAGG + Intergenic
1156905051 18:42342398-42342420 GCTTTTGCAATGGGATTCTGAGG - Intergenic
1164730871 19:30503635-30503657 GACTTTGCAAGGGGATGATGAGG - Intronic
927427235 2:22995190-22995212 GTATTTGCAATGGTTGGCTGAGG - Intergenic
928978324 2:37112340-37112362 GCTTTTGCCAGACTATGCTGTGG - Intronic
929683444 2:44013934-44013956 GCCTTTGAAAGAGTTTGCTGAGG + Intergenic
929762482 2:44817421-44817443 GCATTAGGAAGGATCTGCTGTGG + Intergenic
932422997 2:71612407-71612429 GCATTTGGAAGGTAAAGCTGTGG + Intronic
933495880 2:83049710-83049732 TCATGTGAAAGGATATGCTGGGG + Intergenic
934086217 2:88512077-88512099 GCATCGTCAAGGCTATGCTGTGG - Intergenic
937701421 2:124866758-124866780 GCAGATGCAAGGGCTTGCTGAGG - Intronic
938340938 2:130536085-130536107 GTTTTTGCAAAGGTCTGCTGAGG + Intergenic
938348892 2:130584624-130584646 GTTTTTGCAAAGGTCTGCTGAGG - Intergenic
940906789 2:159176845-159176867 TTATTTGCAAGGGTTTACTGTGG + Intronic
941998149 2:171621062-171621084 GAATTTGAAAGGGGATGGTGTGG + Intergenic
942374065 2:175317941-175317963 GCATGTGCATGTGTGTGCTGAGG + Intergenic
943890200 2:193276968-193276990 GCTTTTGCAAAAGTATGGTGAGG - Intergenic
944287969 2:197973635-197973657 GGATTGGCAAGGGAATGGTGGGG + Intronic
1171002619 20:21430031-21430053 GCATTTGTAGGGGAATGCTCTGG + Intergenic
1175114686 20:56673805-56673827 GTATATGCAAAGGTATGATGGGG + Intergenic
1175720448 20:61282846-61282868 GCATTTGCACGCATGTGCTGTGG + Intronic
1175720449 20:61282885-61282907 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720450 20:61282924-61282946 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720462 20:61283379-61283401 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720463 20:61283418-61283440 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720464 20:61283457-61283479 GCGTTTGCACGCGTGTGCTGTGG + Intronic
1175720466 20:61283494-61283516 GCATTTGCACGCGTGTGCTGTGG + Intronic
1175720468 20:61283531-61283553 GCATTTACACGCGTGTGCTGTGG + Intronic
1175720470 20:61283568-61283590 GCATTTGCACGTGTGTGCTGTGG + Intronic
1175720471 20:61283607-61283629 GCATTTGCACGTGTGTGCTGTGG + Intronic
1181673925 22:24439816-24439838 ACATTTGCAAGGAAATACTGAGG - Intronic
1183693118 22:39402454-39402476 GCATTTGCAAGGGTATGCTGGGG + Intronic
951678641 3:25271271-25271293 GCATTTGCACAGGCATGCTATGG + Intronic
952169700 3:30793177-30793199 GCATTTGTGAAAGTATGCTGTGG - Intronic
952819978 3:37478096-37478118 GCATTGGGAAGGGGCTGCTGGGG - Intronic
958765473 3:98361957-98361979 GATTTTGCAAGGTTATGCTCAGG - Intergenic
964989872 3:162796499-162796521 ACATTTCCAAGTGTATGATGGGG - Intergenic
970119062 4:12732287-12732309 GCATTTGGAAGGGGAGGCTGAGG + Intergenic
978345676 4:107766229-107766251 GAATTTGGAAGGGGATGTTGAGG - Intergenic
983289308 4:165781738-165781760 ACTTTTGCTAGGTTATGCTGAGG - Intergenic
988817561 5:34849915-34849937 GCAATTGGAAGGGGCTGCTGTGG + Intronic
989834832 5:45974146-45974168 GCATCTGCAAAGGGATACTGGGG + Intergenic
996259116 5:121444227-121444249 GCTTTTGTGGGGGTATGCTGTGG - Intergenic
996317996 5:122182862-122182884 GCATGTGCATAGGCATGCTGGGG + Intergenic
998009807 5:138685522-138685544 GCTTTTGCCAGGCTATGCTGTGG - Intronic
1009045840 6:58237053-58237075 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1009221655 6:60991366-60991388 GCATTTGCAGGTGTGTTCTGTGG + Intergenic
1011381957 6:86751641-86751663 GCAATTGCTAGGGTAAGCTTCGG + Intergenic
1012353334 6:98280685-98280707 TCATTTGCAAGGCAATGCAGAGG + Intergenic
1014671215 6:124306077-124306099 GAATCTGCAAGGATTTGCTGAGG + Intronic
1015975103 6:138782345-138782367 GCATTTTCCAGGATATGCTTAGG + Intronic
1020700436 7:11475296-11475318 GCATTGGCAAGGATATGCTTTGG + Intronic
1021243757 7:18236765-18236787 GCTTTTGAAATGGCATGCTGTGG + Intronic
1023186986 7:37542375-37542397 GCATTGGAATTGGTATGCTGGGG + Intergenic
1025611094 7:63076197-63076219 GACTTTGGAAGGGTATGCTGCGG + Intergenic
1026912530 7:74099402-74099424 GCATTTGTAATGGTATTCAGAGG - Intronic
1028677722 7:93486828-93486850 GTATTTGCAAGGGTAGGCATTGG - Intronic
1029479022 7:100801940-100801962 GCATTTGGAGGGGTAAGTTGGGG + Intergenic
1032072997 7:128821165-128821187 GCATGTGCTAGAGTATGCTGAGG - Intronic
1035092052 7:156321231-156321253 GCACTTGTAATGGTATGATGAGG - Intergenic
1036984006 8:13505623-13505645 GTAATTGCGAGGGGATGCTGTGG - Intronic
1037052020 8:14385488-14385510 GCATTTTGAAAGGTATGGTGTGG - Intronic
1039621271 8:38998744-38998766 GTTTTTGCAAGAGTATGGTGGGG + Intronic
1047540598 8:125761981-125762003 CCATTTTCAAGGGGGTGCTGTGG + Intergenic
1048930818 8:139314402-139314424 GCAGTTGTAAGGCCATGCTGTGG - Intergenic
1050591378 9:7163753-7163775 GGAATTGAAAGGGTAGGCTGTGG - Intergenic
1050775957 9:9260579-9260601 GCATTTGAAAGAGTAGGGTGAGG + Intronic
1051532477 9:18120161-18120183 GAACTTGGAAGGGTATCCTGTGG - Intergenic
1052762070 9:32602778-32602800 GCCTTAGCAAGGGTCTGCAGTGG + Intergenic
1053410685 9:37914470-37914492 GCACGTGCATGTGTATGCTGGGG + Intronic
1056236010 9:84595253-84595275 GAATTTGGAAGGGTAGTCTGGGG + Intergenic
1056266809 9:84905322-84905344 GCATGTGCAAGGAAATGATGTGG + Intronic
1056325820 9:85478192-85478214 GTATCTTCCAGGGTATGCTGAGG - Intergenic
1058955834 9:109947449-109947471 TAATTTTCAAGGGTGTGCTGTGG - Intronic
1059692160 9:116696137-116696159 TCATTTTCAAGGGCATGGTGAGG - Intronic
1060474488 9:123976560-123976582 GCATTTGGAGGGACATGCTGGGG + Intergenic
1060476875 9:123993563-123993585 GCATTTGGAGGGACATGCTGGGG - Intergenic
1185850958 X:3486061-3486083 GGATTTGCAAGGGTTCACTGAGG + Intergenic
1190009021 X:46767350-46767372 GCATGTCCAAGGGTAAGCAGAGG - Intergenic
1192235307 X:69291787-69291809 GCTCTTGCAAGGGAAGGCTGTGG - Intergenic
1193149356 X:78108526-78108548 GCCTTTCCAAAGGTAGGCTGAGG - Intronic
1193624022 X:83794597-83794619 GCATGTGGGAGGGTATGCAGTGG - Intergenic
1193677335 X:84471523-84471545 GCTTGTGGAAGGGTATTCTGGGG + Intronic
1194744320 X:97611785-97611807 CAATTAGCAAAGGTATGCTGTGG + Intergenic
1195050798 X:101094881-101094903 GCCTTTGCCAGGGAATGCTGAGG + Exonic
1196811920 X:119635689-119635711 GCATTTGAGTGGTTATGCTGGGG + Intronic
1200055016 X:153455733-153455755 GCATGAGCAAGGGGCTGCTGCGG - Exonic
1200954641 Y:8931048-8931070 GCAGCTGCAAGGATATGCTCTGG + Intergenic