ID: 1183696626

View in Genome Browser
Species Human (GRCh38)
Location 22:39427346-39427368
Sequence CCACATGCCTAATCTCTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 159}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183696626_1183696632 13 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696632 22:39427382-39427404 CCCCAAGGCCTGTCTGTCCCTGG 0: 1
1: 0
2: 1
3: 27
4: 327
1183696626_1183696640 30 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696640 22:39427399-39427421 CCCTGGGCTGCACTGGAGCAGGG 0: 1
1: 0
2: 3
3: 53
4: 596
1183696626_1183696630 -2 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696630 22:39427367-39427389 GGACAGATGGTCAGGCCCCAAGG 0: 1
1: 0
2: 1
3: 27
4: 227
1183696626_1183696629 -10 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696629 22:39427359-39427381 AGGCATGTGGACAGATGGTCAGG 0: 1
1: 0
2: 0
3: 26
4: 274
1183696626_1183696638 29 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696638 22:39427398-39427420 TCCCTGGGCTGCACTGGAGCAGG 0: 1
1: 1
2: 3
3: 40
4: 361
1183696626_1183696637 23 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696637 22:39427392-39427414 TGTCTGTCCCTGGGCTGCACTGG 0: 1
1: 0
2: 2
3: 27
4: 260
1183696626_1183696634 14 Left 1183696626 22:39427346-39427368 CCTGGAAGAGATTAGGCATGTGG 0: 1
1: 0
2: 3
3: 16
4: 159
Right 1183696634 22:39427383-39427405 CCCAAGGCCTGTCTGTCCCTGGG 0: 1
1: 0
2: 4
3: 27
4: 303

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183696626 Original CRISPR CCACATGCCTAATCTCTTCC AGG (reversed) Intronic
901457497 1:9371580-9371602 CCACATTCCTCATCTCGTCGAGG - Intergenic
901911585 1:12463216-12463238 CCACATCCCTTCTCTATTCCTGG + Intronic
902790645 1:18765559-18765581 CCACATGCATCATCTTCTCCAGG - Intergenic
903500354 1:23797033-23797055 CCTCATGCCTTATGTCTCCCAGG - Exonic
906242017 1:44248038-44248060 CCACTTGCCTCCTGTCTTCCAGG - Exonic
907381303 1:54092748-54092770 CCACATGCATAAGCTCTCTCAGG - Intronic
907904887 1:58775505-58775527 GCTGATGACTAATCTCTTCCAGG - Intergenic
908158693 1:61384697-61384719 ACACATGCCTCATCTCCTTCAGG - Intronic
910090528 1:83457856-83457878 CCTCATGTCTAATCTCCTCCTGG - Intergenic
910449833 1:87334026-87334048 CCACTTGCCTAAACTTGTCCTGG - Intronic
910868757 1:91812433-91812455 CTACATGCATAATTTCTTCTTGG + Intronic
913055405 1:115154105-115154127 CCAAATGCTTCATCTCCTCCAGG - Intergenic
915217783 1:154351685-154351707 CCGCATGCCTCACATCTTCCTGG + Intergenic
920841819 1:209561776-209561798 CCACAAGCCTTCTCTCTTCTTGG + Intergenic
923873391 1:238020520-238020542 TCACATGCCTTATCTTCTCCTGG + Intergenic
924591519 1:245408798-245408820 CCACAGGCCTTATCTGCTCCAGG + Intronic
1062889071 10:1043517-1043539 CCACATGCATAGTCTCTGCATGG + Intronic
1064743854 10:18460171-18460193 CAACACTCCTAATCTCTCCCAGG - Intronic
1064766911 10:18684539-18684561 CCACAGCCCTAATCTCACCCTGG - Intergenic
1065664997 10:28049653-28049675 ACACAGGCCTAATCACTGCCTGG - Intergenic
1066049739 10:31622128-31622150 CCGCATGCTTAATTTTTTCCTGG + Intergenic
1067562354 10:47312720-47312742 CCACATTCCGATTCTCATCCAGG - Exonic
1070167928 10:73912019-73912041 CCTCCTCCCGAATCTCTTCCAGG + Exonic
1072016038 10:91347595-91347617 TCACATGTCTAATCTATTGCTGG - Intergenic
1072735532 10:97876582-97876604 CCATTTGCATAATCCCTTCCGGG + Intronic
1074674343 10:115831209-115831231 CCACATGCTCATTCTCTCCCGGG - Intronic
1075466469 10:122655227-122655249 CCAGATCCTTAAACTCTTCCTGG + Intergenic
1076445016 10:130508536-130508558 CCACAAGCCAGTTCTCTTCCAGG - Intergenic
1077002754 11:332797-332819 GCACAGCCCTCATCTCTTCCCGG + Intergenic
1077301925 11:1851479-1851501 CCACCTGCCTGTCCTCTTCCTGG + Intergenic
1078148210 11:8736697-8736719 CCGCATGCCTACTGTATTCCAGG + Intronic
1078547820 11:12258802-12258824 CCACATGGGCAAGCTCTTCCAGG - Intronic
1079313705 11:19389829-19389851 CCACATTGCTAAGCTCTTCATGG + Intronic
1079775133 11:24515677-24515699 TCACATTGCTATTCTCTTCCTGG - Intronic
1079804336 11:24910713-24910735 CCACATGGATAACCTCTTCTAGG + Intronic
1083214672 11:61210888-61210910 CCAAGTGCCTACTCTCTGCCAGG - Intronic
1083217556 11:61229717-61229739 CCAAGTGCCTACTCTCTGCCAGG - Intronic
1088791448 11:113230781-113230803 CCACATGCCTAGACTCTTCCTGG + Intronic
1090364077 11:126191729-126191751 CAACATCCCTAATCCCTTACTGG - Intergenic
1097520190 12:60658090-60658112 TCAAATGCTTAATTTCTTCCTGG + Intergenic
1100109981 12:91229021-91229043 CCAAATGCCACACCTCTTCCTGG - Intergenic
1104280183 12:127369601-127369623 CCACATCCCAAACCGCTTCCTGG - Intergenic
1104494049 12:129219932-129219954 CAACATTCTTACTCTCTTCCTGG + Intronic
1104520260 12:129467674-129467696 CCACATGCCTAAATTCTTTCTGG - Intronic
1107180226 13:37449847-37449869 CCAAATGCTCCATCTCTTCCTGG + Intergenic
1107585003 13:41836430-41836452 CGACATTCCTCATCTTTTCCTGG - Intronic
1108584518 13:51858676-51858698 CCACAAGCCTAATCTTTTCCTGG - Intergenic
1108940440 13:55946975-55946997 CCACATGCCTAATTTTTTCCTGG + Intergenic
1109606822 13:64707241-64707263 CCTAATGCTTATTCTCTTCCAGG + Intergenic
1110124094 13:71920417-71920439 CTACATGGCTCCTCTCTTCCAGG - Intergenic
1110216520 13:73030340-73030362 CCACCAGCCTAGTCTATTCCTGG + Intergenic
1111149162 13:84225951-84225973 TCAAATGCACAATCTCTTCCTGG - Intergenic
1118005468 14:61561329-61561351 CCACTTTCCTCATCCCTTCCGGG - Intronic
1118359200 14:65041869-65041891 TCACATTCCTTATCTCTGCCTGG - Intronic
1119945362 14:78687752-78687774 CCAAATGCTTAATCACTCCCAGG - Intronic
1120440762 14:84535893-84535915 CCACATCCCTAATGTCTTTCTGG + Intergenic
1122296841 14:100710583-100710605 GCACATGCCTAGACGCTTCCGGG - Intergenic
1129029988 15:72611089-72611111 CTACATGCCTAATGCTTTCCAGG - Intergenic
1129038207 15:72663837-72663859 CTACATGCCTAATGCTTTCCAGG - Intronic
1129211683 15:74073394-74073416 CTACATGCCTAATGCTTTCCAGG + Intronic
1129398720 15:75267690-75267712 CTACATGCCTAATGCTTTCCAGG - Intronic
1129402328 15:75291966-75291988 CTACATGCCTAATGCTTTCCAGG - Intronic
1129728805 15:77917669-77917691 CTACATGCCTAATGCTTTCCAGG + Intergenic
1129830379 15:78665700-78665722 TCACATGCATAATGTCTTCAAGG - Intronic
1129839713 15:78736202-78736224 CTACATGCCTAATGCTTTCCAGG - Intergenic
1133760216 16:8792613-8792635 CCACAGGCTTTATCTCTTCATGG + Intronic
1134403596 16:13935507-13935529 CTTCATGCTTAATTTCTTCCGGG - Exonic
1135116032 16:19724144-19724166 CCACAAGCTTTGTCTCTTCCTGG + Intronic
1146710833 17:35040036-35040058 CACCATTCCTAATCTCTTCAAGG + Intronic
1147487637 17:40832919-40832941 CTACAAGTCTGATCTCTTCCAGG - Intronic
1147732540 17:42612989-42613011 CCACATCGCTCATCTCGTCCTGG - Exonic
1149634523 17:58156043-58156065 GCACTTGCCTAATCTCCTCATGG - Exonic
1150649712 17:67001807-67001829 CAACATGGCAAAGCTCTTCCTGG + Intronic
1153296589 18:3552125-3552147 CCCCTTCCCTCATCTCTTCCAGG + Intronic
1157991921 18:52507400-52507422 GCAAATGCTTAATCTCTTCCTGG - Intronic
1158904187 18:61995842-61995864 CCACATGCCTTTCCTCTTCCTGG + Intergenic
1158974057 18:62694570-62694592 CCACCAGCCTGCTCTCTTCCAGG + Intergenic
1161764172 19:6197389-6197411 CCACATACCTCAGCTCCTCCTGG + Intronic
1161959443 19:7515907-7515929 CCCCATCCCTAGTCTCCTCCTGG - Intronic
1162385702 19:10359376-10359398 CCACATGCCAAGTCCCTCCCTGG - Intronic
1164912739 19:32025896-32025918 CCACATGGGTCATTTCTTCCAGG + Intergenic
1166287099 19:41837888-41837910 TCAAATGCCTACTCTCTGCCAGG - Intronic
1167112174 19:47468930-47468952 CCACCAGCCTCATTTCTTCCAGG + Intronic
926440629 2:12884920-12884942 CCACATTGCTAATGTCCTCCAGG - Intergenic
929426991 2:41853801-41853823 CAAGATGCTTAATCTTTTCCAGG + Intergenic
929641670 2:43586393-43586415 GCACTTGCCTATTTTCTTCCAGG + Exonic
930735271 2:54772402-54772424 CCATATGACTATTTTCTTCCTGG - Intronic
931370744 2:61660462-61660484 CCACATGCCAAGTCTCTTCTAGG - Intergenic
932054034 2:68426629-68426651 CCAGAGGTCTCATCTCTTCCAGG + Intergenic
932405733 2:71511785-71511807 CCCCACGTCTCATCTCTTCCAGG + Exonic
936615296 2:114042184-114042206 CCACAGGCTTAAAATCTTCCAGG - Intergenic
939602509 2:144210458-144210480 CCACTTTCCTCATCTATTCCTGG - Intronic
939955447 2:148524186-148524208 CATCAAGCCTAATCTGTTCCAGG + Intergenic
940882831 2:158963774-158963796 CAACATTCCTCATCTCTTTCTGG + Intergenic
942758306 2:179367826-179367848 CCACCTGACTAAGCTGTTCCAGG - Intergenic
946752077 2:222902618-222902640 CCACATGCCTAATTTTTTTCTGG - Intronic
947702359 2:232245023-232245045 CCACATGGATAATTTCTTCAAGG - Intronic
1169895148 20:10496799-10496821 CCCCATTCTTAATTTCTTCCTGG - Intronic
1171016397 20:21545805-21545827 TCACATGCCTTTTCTGTTCCAGG + Intergenic
1171131837 20:22661104-22661126 CCACATGTCTTATGTCTTTCTGG - Intergenic
1172681386 20:36718587-36718609 TCTCATGATTAATCTCTTCCTGG + Intronic
1173862780 20:46295061-46295083 TCGCATGCCTGTTCTCTTCCTGG - Intronic
1173968202 20:47129912-47129934 CCAATTGCCTGATTTCTTCCAGG - Intronic
1175611945 20:60358958-60358980 CCACATCCCGAATCCCCTCCTGG + Intergenic
1175851795 20:62097704-62097726 CCTCATGCCCACCCTCTTCCTGG - Intergenic
1178099570 21:29253114-29253136 CCACATGGAGAATCTCTGCCAGG - Intronic
1179402696 21:41098674-41098696 CCACAACCTTAATCTCTTCCAGG + Intergenic
1179956217 21:44740625-44740647 CCACGTGCCTAATTTTTTCCTGG + Intergenic
1179956935 21:44746142-44746164 TCACGTGCCTAACTTCTTCCTGG + Intergenic
1182096905 22:27631452-27631474 CCACATGCATACTCCCTTCCAGG - Intergenic
1182110529 22:27719906-27719928 CAAGCTGCCTAACCTCTTCCTGG + Intergenic
1182739678 22:32558669-32558691 GCAGGTGCCTAGTCTCTTCCTGG + Intronic
1183477536 22:38043684-38043706 CCACCTGTCTTCTCTCTTCCTGG - Intergenic
1183696626 22:39427346-39427368 CCACATGCCTAATCTCTTCCAGG - Intronic
949269314 3:2195715-2195737 TCACATGGCTATTCTATTCCTGG + Intronic
949303675 3:2614806-2614828 CTCCAGGCCTAGTCTCTTCCTGG - Intronic
955773412 3:62408478-62408500 TCTCAAGCCTAATCCCTTCCAGG - Intronic
957191843 3:77019904-77019926 CCACAAGTCTCATTTCTTCCTGG + Intronic
958824330 3:99012026-99012048 CCACAAGCCTGATCTCAACCTGG - Intergenic
959811084 3:110620233-110620255 ACACATGCCAAATTTCTTTCAGG - Intergenic
959820500 3:110729798-110729820 CCACTTCCCAACTCTCTTCCTGG + Intergenic
960271391 3:115678094-115678116 TCACATGCCTTACCTTTTCCAGG - Intronic
960836921 3:121916290-121916312 CCACATCCCTCTTCTCTTCCAGG - Intronic
963224085 3:142843107-142843129 CCACATTCCTAATCTCCACATGG - Intronic
963727202 3:148936040-148936062 CCACATTCCTCACCTCCTCCAGG - Intergenic
963931841 3:151011606-151011628 CCACATGGTTAATCACGTCCTGG + Intergenic
964335048 3:155645998-155646020 CCACCTGCCTAATCACTCCAGGG - Intronic
966026645 3:175292292-175292314 CCACTTGCCTAAAGTCTTCGAGG + Intronic
967156050 3:186693369-186693391 GCACATGGCTACTCTCTCCCTGG + Intergenic
969129875 4:4983471-4983493 CCACAAGCCTATTCTCTGTCTGG - Intergenic
971114350 4:23627276-23627298 CCACATGCCTAATCTAATCATGG + Intergenic
973040853 4:45468761-45468783 CCAAATGCCTATTCTCTCCTGGG + Intergenic
974849634 4:67388959-67388981 CCACATGCCTGTTCTATTGCAGG + Intergenic
977155507 4:93568097-93568119 CAACATACCTAACCTCCTCCAGG + Intronic
984985371 4:185324199-185324221 CCCCATCCCTTCTCTCTTCCAGG - Intronic
987216410 5:15742472-15742494 CCACATGCCTACACTGTTCTGGG - Intronic
990698984 5:58455021-58455043 TCACTCTCCTAATCTCTTCCAGG - Exonic
991963066 5:72064985-72065007 CCACATGCCTAGTCTCCCCAGGG + Intergenic
992227486 5:74633187-74633209 ACACATGCCTAAGCGATTCCTGG + Intronic
999431350 5:151527983-151528005 CCACATGACTCACCTGTTCCCGG + Exonic
1002647650 5:180668903-180668925 TCACACGCCTAGTGTCTTCCTGG - Intergenic
1004415934 6:15424061-15424083 CCGCATTCCTAAACTCTTTCTGG + Intronic
1006139718 6:31920936-31920958 CCCCATGCCCAGGCTCTTCCAGG - Intronic
1007097482 6:39222538-39222560 TCACATGACTAAGCTCTTCTGGG - Intronic
1015450875 6:133364842-133364864 CTACCTGCCTAATCTCCTCCTGG + Intronic
1015566395 6:134576024-134576046 CCACATGCATAACATCTTCCTGG - Intergenic
1020998997 7:15303935-15303957 CCACAGACCTATTCTCTTCCAGG - Intronic
1022034310 7:26519187-26519209 CCACTTGCCTGTTCTCTTACTGG - Intergenic
1025022453 7:55490265-55490287 CCACATCCCTTATCTCACCCTGG - Intronic
1027307378 7:76914317-76914339 CCTCATGTCTAATCTCCTCCTGG - Intergenic
1030004952 7:105108773-105108795 CCAAATGCCTACTATATTCCAGG - Intronic
1030824247 7:114135101-114135123 GCACATGCCAAATTTCTTTCTGG + Intronic
1032103988 7:129009410-129009432 CCACATGCCTATTTTTTTCTTGG + Intronic
1033239329 7:139664089-139664111 CCTCATGCCCAATCTGATCCAGG + Intronic
1034308834 7:150069615-150069637 TCACATGCCCAAGCTCTCCCTGG - Intergenic
1034798019 7:154031027-154031049 TCACATGCCCAAGCTCTCCCTGG + Intronic
1036912502 8:12768845-12768867 CCACCTCTCTACTCTCTTCCAGG - Intergenic
1044247232 8:89963155-89963177 CTACATACCTAATAGCTTCCTGG + Intronic
1044437734 8:92185685-92185707 CCACATGCCTGTTTTCTTCTAGG + Intergenic
1044883286 8:96746594-96746616 CCACAAGCATTATTTCTTCCCGG + Intronic
1045041485 8:98228478-98228500 TAACTTGCCTAAGCTCTTCCAGG - Intronic
1049173847 8:141179362-141179384 ACTCATGCCTAATCTCTGTCGGG + Intronic
1051848815 9:21485051-21485073 CCTCCTTCCTAATCTCTTCTGGG + Intergenic
1053440005 9:38108393-38108415 CCACTGCCCAAATCTCTTCCAGG - Intergenic
1056310365 9:85334595-85334617 CCAAATGCCTGAACTCTGCCAGG - Intergenic
1056334104 9:85549156-85549178 CCACATACTTATTTTCTTCCTGG + Intronic
1057560952 9:96127344-96127366 CCGTGTGCCTATTCTCTTCCTGG - Intergenic
1060062758 9:120475809-120475831 CCAAATGCCTACTCTGTACCAGG + Intronic
1060351104 9:122860964-122860986 CCAAGTGCCTACTCTGTTCCAGG - Intronic
1060876440 9:127087245-127087267 CCTGGTGCCGAATCTCTTCCTGG + Intronic
1185464612 X:346940-346962 CCACATGCCTCATCCCTCACGGG - Intronic
1185993796 X:4921337-4921359 TTACATACCTACTCTCTTCCAGG - Intergenic
1186772354 X:12830477-12830499 CCACATTCCTAGCCTTTTCCTGG - Intergenic
1190125468 X:47701172-47701194 CCACAGGGCTAATCTCTTAAGGG - Intergenic
1190571260 X:51784598-51784620 CCAGATGCCTATTCATTTCCAGG - Intergenic
1196562982 X:117173180-117173202 CCCCATGCCTAATTTTTTTCTGG + Intergenic
1200525127 Y:4265620-4265642 GCACATACGTACTCTCTTCCTGG - Intergenic
1200653076 Y:5866415-5866437 ACACTTGCCTCATCTCTTTCAGG + Intergenic
1201523677 Y:14906024-14906046 CCTCATGTCTAAGCTCATCCAGG + Intergenic