ID: 1183698141

View in Genome Browser
Species Human (GRCh38)
Location 22:39434770-39434792
Sequence CTCCCATCACAGAGGGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 3, 3: 32, 4: 332}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183698130_1183698141 5 Left 1183698130 22:39434742-39434764 CCTGATCCAGCCCCTTCTTGTCC 0: 1
1: 0
2: 0
3: 38
4: 328
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698127_1183698141 26 Left 1183698127 22:39434721-39434743 CCCAGGTTGTGTGACCAGTCACC 0: 1
1: 0
2: 0
3: 10
4: 97
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698134_1183698141 -6 Left 1183698134 22:39434753-39434775 CCCTTCTTGTCCTGGTTCTCCCA 0: 1
1: 1
2: 1
3: 36
4: 362
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698129_1183698141 12 Left 1183698129 22:39434735-39434757 CCAGTCACCTGATCCAGCCCCTT 0: 1
1: 0
2: 1
3: 20
4: 242
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698135_1183698141 -7 Left 1183698135 22:39434754-39434776 CCTTCTTGTCCTGGTTCTCCCAT No data
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698128_1183698141 25 Left 1183698128 22:39434722-39434744 CCAGGTTGTGTGACCAGTCACCT 0: 1
1: 0
2: 0
3: 19
4: 171
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698133_1183698141 -5 Left 1183698133 22:39434752-39434774 CCCCTTCTTGTCCTGGTTCTCCC 0: 1
1: 0
2: 0
3: 43
4: 439
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698132_1183698141 -1 Left 1183698132 22:39434748-39434770 CCAGCCCCTTCTTGTCCTGGTTC 0: 1
1: 0
2: 4
3: 29
4: 357
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332
1183698126_1183698141 27 Left 1183698126 22:39434720-39434742 CCCCAGGTTGTGTGACCAGTCAC 0: 1
1: 0
2: 2
3: 15
4: 210
Right 1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG 0: 1
1: 0
2: 3
3: 32
4: 332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183698141 Original CRISPR CTCCCATCACAGAGGGGCCA GGG Intronic
900211923 1:1460426-1460448 CTCCCAGCACAGCGGGGCTCAGG + Intronic
900217579 1:1489934-1489956 CTCCCAGCACAGCGGGGCTCAGG + Intronic
900523804 1:3118893-3118915 CTCCCATCAAAGAAAGGCCTGGG + Intronic
901415516 1:9113478-9113500 CTTCCAGAACAGAGGGGCCCTGG + Intronic
901636946 1:10674909-10674931 CTGCCACGACAGAGGGCCCAGGG - Intronic
901679432 1:10904608-10904630 CTCACATCACACAGCGGCTATGG + Intergenic
902406795 1:16188724-16188746 CTCCCAGGACAGACTGGCCAAGG - Intergenic
903873823 1:26458208-26458230 CTTCCAACCCAGAGGGGCTAGGG - Intronic
903919351 1:26788253-26788275 CGCTCACCCCAGAGGGGCCACGG - Exonic
904592470 1:31622668-31622690 CACCCACCACAGAGGGGCATGGG - Intronic
904604338 1:31690645-31690667 CTGCCATCACAGAGGGGCACGGG - Intronic
905237436 1:36559890-36559912 CTCCCATCACAGAAGAGGCTGGG - Intergenic
905861455 1:41354760-41354782 CTCACATGACAGAAGGGGCAGGG + Intergenic
907791774 1:57673180-57673202 CTCACATGACAGAAGGGGCATGG + Intronic
908525611 1:64984886-64984908 CTGCCATCACAGCTGGGCCAGGG + Intergenic
910166921 1:84337594-84337616 CTGCCATCACAGGAGGGCCTAGG - Intronic
911186815 1:94912576-94912598 CTCCCCTCAAGGAGGGGACATGG - Intronic
914314620 1:146498521-146498543 CTCCCAGCAGAAAGGGGCAATGG + Intergenic
914499728 1:148234867-148234889 CTCCCAGCAGAAAGGGGCAATGG - Intergenic
917525644 1:175786030-175786052 CTGCCATGACAGCTGGGCCAGGG + Intergenic
918041426 1:180916334-180916356 ATTCCAGCACAGAGGGGCCCTGG - Exonic
918959352 1:191252479-191252501 CTCCCATCAAAGAATAGCCAAGG - Intergenic
919111811 1:193229464-193229486 CTCCTATCACAGAAGGAGCAAGG - Intronic
920007050 1:202840973-202840995 ATCCCAACACTGAGAGGCCAAGG - Intergenic
920444090 1:206002557-206002579 CTCCCACCACAAAGGTCCCACGG - Intronic
920491029 1:206415491-206415513 CTCCTCCCACCGAGGGGCCAGGG + Intronic
922799775 1:228359926-228359948 CTCCCACCACAGAGGTGCCCAGG + Intronic
923766592 1:236897889-236897911 TCCCCATCTCAGAGGGACCAGGG - Exonic
924618631 1:245639102-245639124 CTCCCATCAAAGAGAAGCCAGGG - Intronic
1065690123 10:28324212-28324234 CTCACGTGGCAGAGGGGCCAGGG - Intronic
1065829967 10:29606159-29606181 ATCCCAGCACTTAGGGGCCAAGG - Intronic
1067215851 10:44302123-44302145 CTCCCAGCACAGAGGCACCTGGG - Intergenic
1067277715 10:44849896-44849918 CTCCCAGCAGAGAGGGGAAAAGG + Intergenic
1067683478 10:48454306-48454328 CTCCCCTCAAGGAGTGGCCAGGG + Intronic
1067944647 10:50682337-50682359 CTCCCATCCCAGCCTGGCCAGGG + Intergenic
1069202357 10:65636634-65636656 CTCCCATCAAAGAGAAGCCTAGG + Intergenic
1069903496 10:71719323-71719345 CTCCCTTCCCACTGGGGCCAGGG + Intronic
1070158313 10:73850245-73850267 ATCCCAACACTGAGAGGCCAAGG - Intronic
1070317621 10:75330478-75330500 CTCCCATCAAAGAAAGGCCCAGG - Intergenic
1070665490 10:78339557-78339579 CTCAAATCACAGAGGGACCTTGG + Intergenic
1070866149 10:79709208-79709230 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1070879943 10:79847339-79847361 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071470759 10:85982586-85982608 CCCACATCACAGAGCTGCCACGG - Intronic
1071633052 10:87231429-87231451 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1071646501 10:87363647-87363669 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1072718891 10:97768833-97768855 CCCCCATCTCTGTGGGGCCAGGG + Intronic
1074862638 10:117523955-117523977 CTCCCATCCAAGAGTGCCCAGGG - Intergenic
1075677409 10:124304895-124304917 CACCCAACAGGGAGGGGCCAAGG + Intergenic
1075911801 10:126131482-126131504 ATACCATCACATGGGGGCCATGG - Intronic
1076107701 10:127836415-127836437 CTGCCATCACACATGGGCCTCGG - Intergenic
1076539834 10:131206910-131206932 CTTCACTCCCAGAGGGGCCAGGG + Intronic
1076630628 10:131849888-131849910 CGCCCAGCACAAAGGGGCCCAGG + Intergenic
1076631142 10:131853096-131853118 CTCCCAACACAGGGGAGGCACGG + Intergenic
1076677594 10:132155462-132155484 TTCCTCACACAGAGGGGCCAGGG + Intronic
1077138618 11:1013739-1013761 CTCCCGGCTCACAGGGGCCAGGG + Intronic
1077339705 11:2020825-2020847 CTCCCCTCTCCGAGGGCCCAGGG - Intergenic
1078062693 11:8058411-8058433 GTCACATCACAGATTGGCCATGG + Intronic
1078515275 11:12016704-12016726 CTCCCATCATAGTGAGACCAGGG - Intergenic
1081493637 11:43584827-43584849 CACCCATCACAGAGGTTACAAGG + Intronic
1081597256 11:44467651-44467673 GTCCCAGCAGAGAGGGGCCATGG - Intergenic
1081716248 11:45252498-45252520 CTCCCGTCACAGCGTGGCCGGGG - Exonic
1083140884 11:60720554-60720576 CTCACATGGCAGAGGGGCCAAGG + Intergenic
1083463926 11:62832882-62832904 CTCCCATCACAAAAGGCTCAGGG + Intronic
1083679676 11:64345332-64345354 CCCCCATCACACAGTGGACATGG - Intronic
1084085930 11:66855267-66855289 CTCCCAGCACTGGGTGGCCATGG + Intronic
1084509198 11:69592572-69592594 CTCCCCAGACAGAGGGGCTAAGG + Intergenic
1084615195 11:70231250-70231272 CTGCCTGCACAGAGGAGCCAGGG + Intergenic
1085764528 11:79271456-79271478 GCCCCATCATGGAGGGGCCATGG - Intronic
1086053197 11:82618310-82618332 TTTCCATGACAGAGGGGCAATGG - Intergenic
1088382614 11:109212319-109212341 CTCCCATCAAAGAAGAGCCCAGG + Intergenic
1088587097 11:111368920-111368942 CTCCGATGACAGATGGGCCATGG - Intronic
1088619944 11:111671555-111671577 CTCCAATCACAGCCAGGCCAAGG - Intronic
1090363499 11:126188742-126188764 CACCCATCACCTAGGGGCCCGGG - Intergenic
1091105620 11:132916803-132916825 CTCCCTTCACAGAGGGGCTGAGG + Intronic
1091276902 11:134358843-134358865 TTCCCATCACAGCAGGGGCAGGG - Intronic
1202822690 11_KI270721v1_random:76014-76036 CTCCCCTCTCCGAGGGCCCAGGG - Intergenic
1093199729 12:16172187-16172209 CTCCCATTACAGTAGGTCCAGGG + Intergenic
1093214125 12:16343259-16343281 CTCACATGACGGAGGGGGCAGGG - Intergenic
1096189219 12:49604270-49604292 CTCCCCTCCCAGAGGAGGCACGG + Intronic
1096882922 12:54687221-54687243 CTCCCTTCAGAGTGGGTCCAGGG - Intergenic
1097484868 12:60183637-60183659 CTCCCATCAAAGAAAAGCCAAGG - Intergenic
1098164262 12:67677387-67677409 ATACCATCACAGTGGGGACAGGG + Intergenic
1100274465 12:93059146-93059168 CTCCCAGCCCAGAGGGGCAGAGG + Intergenic
1102106789 12:110331586-110331608 ATCCCAGCACTGAGAGGCCAAGG - Intronic
1103704140 12:122862334-122862356 CTCCCATCACGGAGGCCCGAGGG - Exonic
1104887227 12:132117706-132117728 CTCCAATCACAGAGCAGCCAGGG + Intronic
1105529993 13:21210602-21210624 CTCCCACCCCAGAGGGAGCAGGG - Intergenic
1105532709 13:21234676-21234698 AGCCCAGCACAGAGGCGCCAGGG + Intergenic
1105708238 13:22981947-22981969 CTCCCAGCCCAGGGGGGCCCGGG + Intergenic
1105899349 13:24742348-24742370 CTCCCATCCCAGACATGCCAAGG + Intergenic
1108088189 13:46818114-46818136 CTCCCAACTCAGAAGGGACAGGG - Intergenic
1108091274 13:46852466-46852488 CTCCAAACACACAGGGGCTAAGG - Intronic
1109527491 13:63596119-63596141 CTTTCATCAGAGAGGGGACATGG + Intergenic
1113037274 13:106063862-106063884 CTGACATCACAGGGGAGCCATGG - Intergenic
1113448702 13:110390264-110390286 GTCCCATCACAGGAGGACCAGGG + Intronic
1113666745 13:112147010-112147032 ATACCATCACACAGGGGTCAGGG - Intergenic
1113666752 13:112147042-112147064 ATACCATCACACAGGGGTCAGGG - Intergenic
1113666790 13:112147204-112147226 ATACCATCACACAGGGGTCAGGG - Intergenic
1113666817 13:112147333-112147355 ATCCCATCACACAGGGGTCAGGG - Intergenic
1113666824 13:112147365-112147387 GTACCATCACACAGGGGTCAGGG - Intergenic
1113666863 13:112147527-112147549 ATCCCATCACACAGGGGTCAGGG - Intergenic
1113666870 13:112147559-112147581 GTACCATCACACAGGGGTCAGGG - Intergenic
1113666893 13:112147656-112147678 ATACCATCACACAGGGGTCAGGG - Intergenic
1113666957 13:112147946-112147968 GTACCATCACACAGGGGTCAGGG - Intergenic
1113666982 13:112148076-112148098 ATACCATCACACAGGGGTCAGGG - Intergenic
1113667003 13:112148173-112148195 GTACCATCACACAGGGGTCAGGG - Intergenic
1113667056 13:112148432-112148454 GTACCATCACACAGGGGTCAGGG - Intergenic
1113667101 13:112148659-112148681 GTACCATCACACAGGGGTCAGGG - Intergenic
1113667115 13:112148724-112148746 ATACCATCACACAGGGGTCAGGG - Intergenic
1113667147 13:112148884-112148906 ATACCATCACACAGGGGTCAGGG - Intergenic
1113667154 13:112148916-112148938 GTACCATCACACAGGGGTCAGGG - Intergenic
1113667253 13:112149433-112149455 GTTCCATCACACAGGGGTCAGGG - Intergenic
1113667261 13:112149465-112149487 ATACCATCACACAGGGGTCAGGG - Intergenic
1113667268 13:112149497-112149519 ATACCATCACACAGGGGTCAGGG - Intergenic
1113667275 13:112149529-112149551 ATACCATCACAGAGGGGTCAGGG - Intergenic
1118702918 14:68451741-68451763 CACCCATCAGAGCAGGGCCAGGG + Intronic
1119985857 14:79136632-79136654 CTCCTCTCACAATGGGGCCAAGG + Intronic
1120663499 14:87278644-87278666 TTCCCAGCCCAGAGAGGCCAGGG - Intergenic
1121422549 14:93825328-93825350 CTGCCATCACGTAGGGGCGAGGG + Intergenic
1122231734 14:100309533-100309555 CTCCCATCCCAGAGGAGGCAGGG + Intergenic
1122799068 14:104220903-104220925 CGCCCGCCACAGAGGGGACACGG - Intergenic
1202856231 14_GL000225v1_random:53551-53573 CGCCCATTTCAGAGGAGCCAGGG - Intergenic
1124254312 15:28128767-28128789 CTCCCTTCCCAGAGGCCCCAGGG + Intronic
1124426992 15:29570781-29570803 CTCTCCTCACAGAGGGTCCGAGG + Intergenic
1124487067 15:30127673-30127695 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124542152 15:30596648-30596670 CTCCGTTTACAGATGGGCCAAGG + Intergenic
1124667447 15:31605444-31605466 CACCCACCCCAGAGGGCCCAGGG - Intronic
1124756458 15:32410650-32410672 CTCCGTTTACAGATGGGCCAAGG - Intergenic
1125227224 15:37408776-37408798 CTCCCATCACAGCTGTGCTAAGG + Intergenic
1125233490 15:37484339-37484361 CTCCCATCACAGAGGCCCAGAGG - Intergenic
1125733899 15:41910297-41910319 CTCCCATAACAGGGGGGTTATGG - Intronic
1128300856 15:66565600-66565622 CCCCCATCAGACAGGAGCCAAGG - Intronic
1128781866 15:70363948-70363970 CTCCCATCAAAGAAAAGCCAAGG + Intergenic
1129056446 15:72823766-72823788 CTGGCATCACTGTGGGGCCAGGG - Intergenic
1130635959 15:85620246-85620268 CTCCCAATACAGGAGGGCCAGGG - Intronic
1131571478 15:93541687-93541709 CTCCCATCACTGAGTGCCCTGGG - Intergenic
1132371642 15:101303487-101303509 CTGACTTCACAGAGAGGCCATGG + Intronic
1132538587 16:496426-496448 CTCCTGTCACAGCGGGGCCTGGG + Intronic
1132728040 16:1347212-1347234 CCCCCAGCACAAAGGGGCCCAGG - Intronic
1133592937 16:7263643-7263665 ATCCCAGCACAGAGAGGCCGAGG + Intronic
1133773701 16:8882518-8882540 CTCCCCTCATTCAGGGGCCAGGG + Intergenic
1134894339 16:17871296-17871318 GTCCCATCACAGAGATGACAAGG + Intergenic
1137757903 16:50917212-50917234 ACCTCATGACAGAGGGGCCAGGG - Intergenic
1138029397 16:53547977-53547999 CTCACATCTGAGAGGGGCCAGGG + Intergenic
1139273035 16:65701047-65701069 CTCCCAACAGGGAGGAGCCAAGG + Intergenic
1139445439 16:66995453-66995475 TTCCCATGACAGATGGGCCAGGG + Intronic
1140411460 16:74743515-74743537 TCCCCCGCACAGAGGGGCCAGGG + Intronic
1141457649 16:84154518-84154540 CTCCCAGGGCAGAGGGGTCACGG - Intronic
1142285649 16:89170532-89170554 CTCCCATCACAGAGAGGAACGGG + Intergenic
1143729913 17:8875605-8875627 CTCGGATCACAGGGAGGCCAGGG - Intergenic
1144023086 17:11254265-11254287 ATCCCACAGCAGAGGGGCCAAGG - Intronic
1144726738 17:17506079-17506101 CTCCCAGGTCAGAGCGGCCATGG - Intronic
1144798616 17:17910290-17910312 CTCACATCCCAGAGGGGGAAGGG - Intronic
1145235483 17:21205144-21205166 CCCACATCCCAGAGGGGCCGTGG - Intronic
1145936515 17:28717702-28717724 CTACCATTACAGAGCGGCCCGGG + Intronic
1148017075 17:44529349-44529371 ATCCCAGCACGGAGAGGCCAAGG - Intergenic
1149657282 17:58316821-58316843 CCCTCATCTCAGAGGGGCCCAGG + Intronic
1149814872 17:59713788-59713810 ATCCCAACACTGAGAGGCCAAGG + Intronic
1149867033 17:60156806-60156828 CTCACAGCACAGATGGGCCTGGG - Intronic
1150907971 17:69358909-69358931 CTCACATGACAGAGGGGGGAAGG - Intergenic
1151718344 17:75842786-75842808 CTCCCATCACAGCCTGGCCCAGG - Intronic
1152112734 17:78366066-78366088 CTCCACCCACAGAGGGGCCCTGG + Intergenic
1152268628 17:79310673-79310695 CTCCCTCCACAGAAGGGCCCGGG - Intronic
1152582680 17:81173675-81173697 CTCCCATCAAAGAAAGGCCCAGG + Intergenic
1152698312 17:81806979-81807001 CCCCCAACCCAGAGGGGCCCTGG - Intronic
1153821648 18:8837280-8837302 CTCTCAGCAGAGAGGGGCCATGG + Intergenic
1155398784 18:25415932-25415954 CTCCTATCACAGAGGGCTCTTGG + Intergenic
1156543852 18:37944433-37944455 CTCAAATCACCAAGGGGCCAGGG - Intergenic
1159873349 18:73783534-73783556 CTCCCATCACCGAGCAGCCCTGG + Intergenic
1161286781 19:3472408-3472430 ATCTCATCACCCAGGGGCCAAGG - Intergenic
1162968234 19:14165747-14165769 CCCCCATCTCAGAGAGGCCTGGG - Intronic
1163155806 19:15439380-15439402 CTCCCGCCACATGGGGGCCAAGG + Intronic
1163338413 19:16688408-16688430 CTCCCAGCTCAGAGGGTCCTGGG - Exonic
1163817333 19:19474933-19474955 CTTCCATCAAAGAGGGACAAGGG - Intronic
1163825807 19:19524221-19524243 CGCCAACCACAGGGGGGCCAAGG - Intronic
1164507171 19:28870037-28870059 CTCCCATCACAGAGGAGGGTGGG - Intergenic
1164869634 19:31632077-31632099 ATCAGATCACAGTGGGGCCATGG + Intergenic
1165059534 19:33198348-33198370 CTCCCATCACAGAGGGCACCAGG - Intronic
1165823822 19:38694117-38694139 CTGCCTTCACAGGAGGGCCAGGG + Intronic
1166682430 19:44777323-44777345 GTCCCTTCAGAGAGGGGCAAGGG - Intergenic
1166843183 19:45711457-45711479 CACCCTTCTCAGAGGGTCCACGG + Exonic
1168160981 19:54509780-54509802 CTCCCATCACACAGAGTCCAGGG - Intronic
1168353351 19:55688514-55688536 CTCCCATCCCCCAGGGGCCCAGG + Intronic
925109225 2:1319503-1319525 CTCTCATCCCAGGGGTGCCACGG - Intronic
925619600 2:5778548-5778570 CTACCATCTCACTGGGGCCAAGG - Intergenic
927282094 2:21317881-21317903 CTCCCACCACAGTGGGGCAAAGG + Intergenic
927746424 2:25625935-25625957 CTCACATGACAAAGGGGCAAAGG - Intronic
929967911 2:46549222-46549244 CTCTCATCTCTGAGGGGCCGGGG + Intronic
931406402 2:61983151-61983173 CTCCCATCAAAGAAGAGCCCAGG - Intronic
932889322 2:75578514-75578536 CTCACATGACAGAAGGACCAAGG - Intergenic
933103299 2:78287667-78287689 CTCTCAGCAAAGAGGGGACATGG - Intergenic
936053898 2:109246346-109246368 CTCCCATGGTAGAGGGGGCAAGG + Intronic
937321885 2:120965896-120965918 CTGACCCCACAGAGGGGCCAGGG - Intronic
938260609 2:129892661-129892683 CTCCTGTGACAAAGGGGCCAAGG - Intergenic
939054186 2:137343257-137343279 CTCCCATCACAGAAAAGCCAAGG - Intronic
939317515 2:140570538-140570560 CTCCCATCAGAGAAAGGCCCAGG + Intronic
940168762 2:150803899-150803921 CTCTCAGCAAAGAGGGGACATGG + Intergenic
941688999 2:168478748-168478770 CACCCAAGACAGAAGGGCCAGGG - Intronic
941898274 2:170652813-170652835 CTCCCAGTACAGAGGTACCAGGG - Intronic
942564903 2:177256745-177256767 CCCCCAACACAAAGGGGCAACGG + Intronic
943253507 2:185563232-185563254 CTCCCATCAAATAGGAGCCCAGG + Intergenic
943659312 2:190540856-190540878 CTCCCATCAAAGAAAGGCCCAGG - Intergenic
945650412 2:212551637-212551659 CTCCCATGATAGAAGGGGCAAGG + Intergenic
946252318 2:218421235-218421257 GTGCCAGCAGAGAGGGGCCAGGG + Intronic
946677728 2:222180249-222180271 ATCCCAGCACTGAGAGGCCAAGG + Intergenic
946731890 2:222717799-222717821 ATCCCAACACTGAGAGGCCAAGG + Intergenic
948146097 2:235709256-235709278 CTCCCTTCCCACAGGTGCCAGGG - Intronic
948180508 2:235976146-235976168 CTCCCATCACTGACAGCCCAAGG - Intronic
948930182 2:241127012-241127034 CTGCCATCCCAGAGGGGCTGGGG + Exonic
949072014 2:242031012-242031034 CTCCCACTGCAGAGGGGTCAGGG + Intergenic
1168931615 20:1629081-1629103 TTCCCATCACAGAGAGAGCAGGG + Intergenic
1169717631 20:8638265-8638287 CTCCTATCATAAAGGAGCCAAGG + Intronic
1170864765 20:20143384-20143406 CTCCCAGCAAAGAGGGGACTCGG + Intronic
1171846705 20:30281755-30281777 TTCCCATCACAGTGGTTCCACGG + Intergenic
1172771997 20:37387291-37387313 CTGCCTTCTCAGAGGGGCAAAGG + Intronic
1173366611 20:42391527-42391549 CTCCCATCACAGAGGCAACCTGG + Intronic
1174355997 20:49998237-49998259 CTCCCATCACAGTGGCCCCAGGG - Intergenic
1175399767 20:58693432-58693454 CTTCCACCAGAGAGGGGGCAGGG - Intronic
1175758462 20:61545027-61545049 CTGCCATCTGAGAGGGCCCAAGG - Intronic
1175954102 20:62599513-62599535 CTCCCATGACAGAGGAGCCTGGG - Intergenic
1176261968 20:64186672-64186694 TTCCCACCACAGAGTGTCCATGG + Intronic
1179179001 21:39029447-39029469 CTCCAATCACTGAGAGCCCAGGG - Intergenic
1182269689 22:29145591-29145613 CTGCCTTCTCAGAAGGGCCAAGG - Intronic
1182799942 22:33023789-33023811 CAACAATCACAGAGGGGCCCAGG - Intronic
1183172291 22:36197297-36197319 CTCCCCTTACAGAGTTGCCATGG - Intronic
1183180967 22:36259447-36259469 CTCCCCTTACAGAGTTGCCACGG + Intronic
1183698141 22:39434770-39434792 CTCCCATCACAGAGGGGCCAGGG + Intronic
1184248208 22:43246224-43246246 CACCCTTCACTGAGGAGCCAGGG - Intronic
1184594118 22:45503694-45503716 CTCCCGGGACAGAGGGCCCAAGG + Intronic
1185126621 22:49014740-49014762 CTCCCAGCACAGAAGGTGCAGGG + Intergenic
1185225098 22:49647707-49647729 ATCCCAACCCAGAGGGCCCAGGG + Intronic
949553483 3:5132137-5132159 CTCCCAACACTGGGAGGCCAAGG - Intronic
950083227 3:10238657-10238679 CTCCCAGCAGAGAGGGGGCGGGG - Intronic
951522543 3:23622700-23622722 CTCCCATCACAGAAGGGGCAAGG + Intergenic
951946938 3:28148832-28148854 CTCCCATTGCACAGGGGCCCAGG - Intergenic
952865823 3:37854563-37854585 CTCCCAGAGCAGAGGGGGCAGGG - Intergenic
953251887 3:41251669-41251691 CTGCCATCACAGAATGGCCTGGG - Intronic
953311436 3:41883942-41883964 CTCCATTTACAGACGGGCCAAGG - Exonic
953704477 3:45220763-45220785 CACCCATCACAAGGGAGCCAAGG - Intergenic
954173697 3:48826010-48826032 CTCCCAGCACTGAGAGGCTAAGG + Intronic
957398218 3:79672828-79672850 CTCTCCTCACAGATGGGCCCAGG - Intronic
957599744 3:82319245-82319267 CTGCCATCACAGCGGAGGCAAGG - Intergenic
958880512 3:99664104-99664126 CTCCCATCATAGAAAGGACATGG + Intronic
961030802 3:123601864-123601886 ATCCCAGCACTGAGAGGCCAAGG - Intergenic
961510073 3:127395521-127395543 CTGCCATCACAGGGAAGCCAGGG - Intergenic
961643511 3:128379967-128379989 CACCCAACACACAGGGGCCGAGG - Intronic
961667020 3:128498881-128498903 CCCCTATCCCAGAGGGGCCTGGG + Intergenic
962249392 3:133826144-133826166 CTCCCATCTCAGTGGTTCCATGG - Exonic
962881268 3:139578963-139578985 TTCTCATCACCGAGTGGCCATGG - Exonic
968489229 4:881194-881216 CTCCCGCCACGGTGGGGCCACGG + Intronic
968763744 4:2457517-2457539 CTGCCGTCACTCAGGGGCCAGGG - Intronic
968910714 4:3475832-3475854 CTCCCACCACGGAGGTGCTAGGG - Intronic
968911197 4:3477755-3477777 CTCCAATCCCAGAGGGGCCAAGG - Intronic
969227176 4:5806330-5806352 ATCCCAGCACCGAGAGGCCAAGG - Intronic
969328476 4:6458422-6458444 CTCACATGACAGAAGGGCAAGGG + Intronic
969392554 4:6901236-6901258 CTCCAGCCACAGAGGGGCCTTGG + Intergenic
969981928 4:11166512-11166534 CTCCCATTAAAGATGGGGCAGGG - Intergenic
971058221 4:22937427-22937449 CTTCCCTCACTGAGGGCCCAAGG - Intergenic
971755773 4:30706296-30706318 CACTCATCACAAAGGGGACAGGG - Intergenic
972001945 4:34048438-34048460 CTCCCATCACAGTGGGGAAAAGG + Intergenic
975416367 4:74109756-74109778 CTCCCATCTCAGAGTGGCCAAGG + Intergenic
976771491 4:88657976-88657998 CTCCCATCACACTGTGTCCACGG - Intronic
976997732 4:91456307-91456329 ATACTATCACAGAGGGGCTAGGG + Intronic
978010154 4:103671416-103671438 CTCCCATCAAAGAAGAGCCCAGG - Intronic
982608487 4:157543111-157543133 CTCCCATCAAAGAAAGGCCCAGG - Intergenic
985508123 5:296345-296367 CTCTCGCCACAGAGGGGTCAGGG + Intronic
985558433 5:569488-569510 CTGCCATCAGAGAGGGCCCCGGG - Intergenic
985739913 5:1609324-1609346 CTCTCGCCACAGAGGGGTCAGGG - Intergenic
986165661 5:5269606-5269628 CTCCCATCACAAAGGGCAGATGG + Intronic
986351581 5:6885235-6885257 CTCCCAGCATAGAAGTGCCATGG - Intergenic
986434807 5:7718684-7718706 TTCCCGTCACAGAGTGTCCAAGG + Intronic
988018916 5:25597974-25597996 ATCCCAACACTGAGAGGCCAAGG - Intergenic
990911614 5:60857787-60857809 ATCCCAACACCGAGAGGCCAAGG - Intergenic
995587983 5:113669188-113669210 ATCCCATCAAAAAGGGGCAAAGG + Intergenic
997023131 5:130025697-130025719 CTCCCATAGCAGAAGGGCCAGGG + Intronic
997654934 5:135547639-135547661 CACCCATCACAGAGGGCCTGGGG - Intergenic
998390542 5:141784434-141784456 CTCCCATCCCATAGGAGCCTGGG + Intergenic
999210314 5:149882448-149882470 GACCCATCACAGAGGAGCCAGGG + Intronic
1001293928 5:170485637-170485659 TTCCCTTCCCAAAGGGGCCAGGG + Intronic
1002055466 5:176595906-176595928 CTCACAGCACAGGGGGGACAAGG + Exonic
1002462922 5:179385022-179385044 ATCCCATCACAGCGGGGACTAGG + Intergenic
1003638552 6:7857125-7857147 CTCCCATCACACAGCCTCCAAGG - Intronic
1003682524 6:8269973-8269995 CTGCCATGCCAGAGAGGCCATGG - Intergenic
1005790480 6:29295442-29295464 CTCCCAGCACACAGGAGCCCCGG - Intergenic
1005843768 6:29762009-29762031 CTCCCATCTCACTGGAGCCATGG - Intergenic
1006764580 6:36493500-36493522 CTCCCCTCACAGTAAGGCCAAGG - Intergenic
1007301166 6:40868929-40868951 CTCCCAGTACAGAGGGGCCCAGG - Intergenic
1010753551 6:79641301-79641323 CTCCCATCAATGAAGGGCCCAGG - Intronic
1012865932 6:104617665-104617687 TTCCCCTCACAGTGAGGCCACGG - Intergenic
1013054287 6:106568300-106568322 CTCTCATCCCACAGGGGCCCAGG + Intronic
1013571689 6:111433567-111433589 CTCCCATCAAAGAAGAGCCCAGG + Intronic
1013595656 6:111658327-111658349 ATCCCAACACTGAGAGGCCAAGG + Intergenic
1015414869 6:132936882-132936904 CTCCAATCACAGAGTACCCAGGG + Intergenic
1015791700 6:136969847-136969869 CTCCCGTCCCAGAGGGCCTACGG - Intergenic
1016822578 6:148360599-148360621 ATCCCAACACTGGGGGGCCAAGG - Intronic
1017130503 6:151104511-151104533 CTCCCATCTGAGAGTAGCCACGG + Intergenic
1018211896 6:161490240-161490262 CTCCCAGCACAAAAGTGCCATGG + Intronic
1018642949 6:165921735-165921757 CTGCCATCACAGTGAGCCCATGG + Intronic
1019143120 6:169960762-169960784 CTCCCTTCAGAGAAGGACCAGGG + Intergenic
1019277557 7:183873-183895 CCCCCAGGACAGAGGGGCCCGGG - Intergenic
1019632074 7:2054854-2054876 CTCCCATCACTGCGAGGGCACGG - Intronic
1020678201 7:11204775-11204797 AGCCCATCACAGAGGGGTCAAGG - Intergenic
1021561561 7:21972689-21972711 CTCCCAACTCAGAAGGGGCAGGG + Intergenic
1023089186 7:36601807-36601829 AACCAAGCACAGAGGGGCCAGGG + Intronic
1023117260 7:36874675-36874697 CTCCCACATCAGAGGGGGCAGGG - Intronic
1024219014 7:47273353-47273375 GTCCCATCTCAGAGAGTCCAGGG - Intergenic
1024308228 7:47945945-47945967 CTCCACTCACAGAGGCGCCAAGG + Intronic
1024320184 7:48058324-48058346 CTCCCATCACAGAAAAGCCCAGG - Intronic
1024579212 7:50788294-50788316 CTGCCATCTCAGTGGGGCCCAGG + Intronic
1025232472 7:57211790-57211812 CACCCAGCACTGAGAGGCCACGG - Intergenic
1026284516 7:68951413-68951435 GTCCCATCAGAGAGGAGCTATGG - Intergenic
1026501448 7:70946487-70946509 CTCCCTTCCCAGAGGAGCCTTGG + Intergenic
1029029698 7:97454587-97454609 CTCATATCACAGAAGGGGCAAGG - Intergenic
1029189446 7:98761388-98761410 CTCCCAGCTCAGTGGGGACAAGG - Intergenic
1032197267 7:129796583-129796605 CTCCCAGGACAGAAGGGACAGGG - Intergenic
1034193057 7:149225619-149225641 CTCCCAGGGCAGAGGGGCGAGGG + Exonic
1034434108 7:151054985-151055007 CTCCCCTCCCAGAGGGCTCAAGG + Intronic
1034801569 7:154059016-154059038 CCCCCATCGCAGAGGGGGGAGGG + Intronic
1034802758 7:154063267-154063289 CCCCCATCGCAGAGGGGGGAGGG + Intronic
1035073181 7:156159565-156159587 CTGCCATCAAAGAGTGCCCAAGG - Intergenic
1036591233 8:10170360-10170382 CTCACATCACAGAAGGCGCAAGG - Intronic
1038077506 8:24092872-24092894 CTCCCATCAAAGAAAAGCCAAGG - Intergenic
1038562950 8:28596424-28596446 CTCTCAGCAGAGAGGGGACACGG + Intergenic
1039622092 8:39007262-39007284 ATGCCATCCCTGAGGGGCCAGGG - Intronic
1040288769 8:46113709-46113731 CTCCCATCACAGAAGTCCCCAGG - Intergenic
1040289803 8:46118452-46118474 CTCCCATCACAGAAGCCCCCAGG - Intergenic
1040292474 8:46132479-46132501 CTCCCATCCCAGAAGCTCCAGGG - Intergenic
1040303911 8:46202328-46202350 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040315119 8:46256958-46256980 CTCCCATCACAGAAGCCCCCAGG + Intergenic
1040324759 8:46336080-46336102 CTCCCATCCCAGATGCCCCAGGG + Intergenic
1040333262 8:46403188-46403210 CTCCCATCCCAGAAGCCCCAGGG + Intergenic
1040338260 8:46427108-46427130 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040338363 8:46427536-46427558 CTCCCATCCCAGAAGGCCCCAGG + Intergenic
1040338412 8:46427753-46427775 CTCCCATCTCAGAAGGCCCAGGG + Intergenic
1040339047 8:46430746-46430768 CTCCCATCCCAGAAGGCCCAGGG + Intergenic
1040594263 8:48822269-48822291 CACTCATCACAGAGGGGCCGGGG + Intergenic
1040606583 8:48939236-48939258 CTCCCCTCACCGACAGGCCATGG + Intergenic
1044306896 8:90648498-90648520 ACCCCATCACAGGGAGGCCAGGG - Intronic
1045016275 8:98004034-98004056 ATCCCAGCACAGGGAGGCCAAGG + Intronic
1045183280 8:99809962-99809984 CTCCCATGACAGAGTGGGCCTGG + Intronic
1045649746 8:104330355-104330377 CTCCCAAGACAGTGGGTCCAGGG + Intronic
1046647099 8:116797373-116797395 TTCCCATCACAGATGAGCCCAGG - Intronic
1046741752 8:117836609-117836631 CTCCCACCACAAAGGCTCCAGGG + Intronic
1049180444 8:141219456-141219478 CACCAAGCACAGTGGGGCCAAGG - Intronic
1050767817 9:9157630-9157652 CTCCCATCAAAGAGAAGCCCAGG + Intronic
1054160906 9:61671601-61671623 CTCCCATCACAGTGGTTCCCAGG - Intergenic
1054161375 9:61674055-61674077 TTCCCATCACAGTGGTTCCACGG - Intergenic
1056804533 9:89718401-89718423 CTCCACTCCCAGAGGTGCCAAGG + Intergenic
1057039852 9:91840132-91840154 CTCCCAGGACAGCGGGGCCTCGG - Intronic
1057354319 9:94321798-94321820 CTCCCATCCCAGCCTGGCCAGGG - Intronic
1057653445 9:96935837-96935859 CTCCCATCCCAGCCTGGCCAGGG + Intronic
1059744923 9:117190635-117190657 CTCCAATCACACTGGTGCCAGGG + Intronic
1060230161 9:121820072-121820094 CTCCCGGGACAGAGGGGCCATGG + Intergenic
1060705925 9:125801001-125801023 ATCCCAACACTGGGGGGCCAAGG - Intronic
1060840977 9:126792979-126793001 CTCCCCACACAGAGGGGCGGAGG - Intergenic
1061749232 9:132764677-132764699 CTCCCATCACAGAAAAGCCCAGG + Intronic
1185666185 X:1767227-1767249 CTCCCATCACAGATGATCCTTGG - Intergenic
1185780022 X:2836000-2836022 CTCCCAGCACATGGTGGCCATGG - Intronic
1189175994 X:38957757-38957779 CCCCACTCACAGAGAGGCCATGG + Intergenic
1189377353 X:40475999-40476021 CTCCCTGCTCAGAGAGGCCAGGG - Intergenic
1191053689 X:56221307-56221329 ATTCCAACACAGAGTGGCCAAGG + Intergenic
1191754274 X:64577244-64577266 CTCTCAGCAGAGAGGGGACACGG - Intergenic
1192795669 X:74422387-74422409 CCCCCAGCACACAGGGGCAAAGG - Intronic
1192954574 X:76055309-76055331 ATCCCATCAAAGAGTGGGCAAGG - Intergenic
1197101001 X:122655294-122655316 CTCCCATCACAGAAAAGCCCAGG + Intergenic
1197303393 X:124809313-124809335 CTCCCATCACAGAAGAACCCAGG + Intronic
1199529393 X:148830093-148830115 GTCCCATCTCAGTGGGGGCATGG - Intronic
1201290027 Y:12413989-12414011 CTCCCAGCACATGGTGGCCATGG + Intergenic