ID: 1183698255

View in Genome Browser
Species Human (GRCh38)
Location 22:39435450-39435472
Sequence GCCCTTCAGGGGCTGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 414
Summary {0: 1, 1: 0, 2: 5, 3: 42, 4: 366}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183698255_1183698262 -4 Left 1183698255 22:39435450-39435472 CCCTCACCCAGCCCCTGAAGGGC 0: 1
1: 0
2: 5
3: 42
4: 366
Right 1183698262 22:39435469-39435491 GGGCAGCGATTTGTGTCTGAAGG 0: 1
1: 0
2: 1
3: 6
4: 91
1183698255_1183698265 17 Left 1183698255 22:39435450-39435472 CCCTCACCCAGCCCCTGAAGGGC 0: 1
1: 0
2: 5
3: 42
4: 366
Right 1183698265 22:39435490-39435512 GGTTCGCTGGGTCCTACTGCTGG No data
1183698255_1183698263 4 Left 1183698255 22:39435450-39435472 CCCTCACCCAGCCCCTGAAGGGC 0: 1
1: 0
2: 5
3: 42
4: 366
Right 1183698263 22:39435477-39435499 ATTTGTGTCTGAAGGTTCGCTGG 0: 1
1: 0
2: 0
3: 3
4: 66
1183698255_1183698264 5 Left 1183698255 22:39435450-39435472 CCCTCACCCAGCCCCTGAAGGGC 0: 1
1: 0
2: 5
3: 42
4: 366
Right 1183698264 22:39435478-39435500 TTTGTGTCTGAAGGTTCGCTGGG 0: 1
1: 0
2: 0
3: 9
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183698255 Original CRISPR GCCCTTCAGGGGCTGGGTGA GGG (reversed) Intronic
900095048 1:936758-936780 GCCCTTGTGGGGCTGGGTGGGGG + Intronic
900344739 1:2205273-2205295 GCCCATGAGGGGCGGGGTGTGGG - Intronic
900900831 1:5514526-5514548 GTGCTTCAGGGTCTTGGTGATGG - Intergenic
901316800 1:8315140-8315162 GCCCTTCCGGTCCTGGGTGTGGG - Intergenic
901788820 1:11642467-11642489 GCTCTTCAGGGGCTGGGATTTGG - Intergenic
901941553 1:12666113-12666135 GCCCACCAAGGCCTGGGTGATGG - Exonic
902242535 1:15098672-15098694 GCCCTTGAGGGACTGGGAGGGGG + Intronic
902776193 1:18676476-18676498 GCCCATGAGTGGCTGGGGGAGGG + Intronic
903999210 1:27328948-27328970 GCCCTACAGGACCTGGGTGCTGG - Intronic
904468022 1:30719332-30719354 GCCCGGCCGGGGCTGGGTGGGGG + Intronic
904992331 1:34603102-34603124 GCACGTCAGGGGCTGGGTGAGGG + Intergenic
905180229 1:36160979-36161001 GCCCTGCTGGGGCTGAGGGAGGG + Intronic
905233516 1:36530138-36530160 GCCCATCAGGGGGTGGGGGTGGG + Intergenic
905580838 1:39081838-39081860 GCCCTGCAGGGGCCGGGCGCCGG + Intronic
905653049 1:39669182-39669204 GCCTTTCAGGGTCAGGCTGATGG + Intronic
905863081 1:41363101-41363123 TCCATTTAGGGGCTGGGGGAGGG + Intronic
906769859 1:48474389-48474411 GCACTCCAGAGCCTGGGTGACGG - Intergenic
907460980 1:54605304-54605326 GCCCTGCTGGGGCTGGGGGTGGG + Intronic
907825317 1:58011169-58011191 GCCCCTCAGGGGCTAGGAAAAGG + Intronic
908757181 1:67479680-67479702 GCATTTGAGGGGCTGGGGGACGG + Intergenic
908890059 1:68836287-68836309 GCCCTTCAGGTGCTGGCATATGG + Intergenic
912546361 1:110454261-110454283 GACATTCAGGGGCTGGATCAGGG - Intronic
912702900 1:111891514-111891536 GCCCTTCGGGAGCTGAGGGAGGG - Intronic
912717380 1:111991485-111991507 GCCCTTCAGGAGGTGGGCGTGGG + Intergenic
913264891 1:117034391-117034413 GCCCTCCAGAGGCTGTGTGAGGG - Intronic
913452132 1:118999640-118999662 GCCATGCCGGGGCTGGGTGAGGG - Intergenic
915003441 1:152614399-152614421 GACCTTCAGGAGCTGAGGGAGGG - Intergenic
915641436 1:157230193-157230215 ACCATTCAGGGGAAGGGTGAAGG + Intergenic
915667244 1:157456301-157456323 CACCTTCAGGGGAAGGGTGAAGG - Intergenic
915896357 1:159814116-159814138 GCCCATCAGGGGCTCTGTTATGG - Intronic
918414353 1:184291273-184291295 CCCCTGTAGGTGCTGGGTGATGG + Intergenic
920221830 1:204409989-204410011 GCCCTTCAGGGTCTTGTTCAAGG + Exonic
920303030 1:205001159-205001181 GCTCATCAGGGGCTGGTGGACGG - Exonic
920960214 1:210656881-210656903 CCCCTCCAGGGGCTGGCTGCTGG + Intronic
921561729 1:216667098-216667120 GCCCTTCAGGTGCTGACTGTGGG - Intronic
922766438 1:228158818-228158840 GCCCTGCAGGCGCTGCGCGACGG + Exonic
922789995 1:228306110-228306132 GCCCTTTGGGGGCTGGGTGGGGG + Intronic
922871239 1:228903680-228903702 GCTCTCCAGGCTCTGGGTGAAGG - Intergenic
924072110 1:240291361-240291383 GACCTGCAGGGGGTGGGTGGGGG + Intronic
1063382235 10:5592697-5592719 GCCCTTCAGGGCCACGGTGCAGG + Intergenic
1065973241 10:30821790-30821812 CTCCAGCAGGGGCTGGGTGATGG + Intronic
1066244137 10:33566033-33566055 GCACTTCGGGGGCTGGGAAATGG + Intergenic
1067606669 10:47670023-47670045 GGCTTCCAGGGGCTGGGGGAGGG - Intergenic
1067723637 10:48749860-48749882 GCCTGGCAGGGGCTGGGAGAAGG - Intronic
1067944755 10:50682728-50682750 GCTCTGCGGGGGCTGGGTGAGGG + Intergenic
1069100825 10:64318431-64318453 GCCCTACAGGGGCGGGGTGCAGG - Intergenic
1069906758 10:71736510-71736532 GGCCTTCAGGGGGTAGGGGAGGG + Intronic
1070500845 10:77071163-77071185 GCCCATCAGGGTCTGGAGGAAGG + Intronic
1070630600 10:78081973-78081995 CCCCGTCCTGGGCTGGGTGACGG - Intergenic
1070866256 10:79709599-79709621 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1070880050 10:79847730-79847752 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1071633162 10:87231820-87231842 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1071646611 10:87364038-87364060 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1073058040 10:100714549-100714571 ATCCTACAGGGGCTGAGTGAGGG - Intergenic
1073265967 10:102228630-102228652 ACCCTCCATGGGATGGGTGAAGG - Intronic
1073266397 10:102230761-102230783 GCCCTGCAGGGCCTGGGCGGGGG - Exonic
1075307055 10:121377493-121377515 GCCCTTTTGGGGCTGGGAGAGGG - Intergenic
1075370464 10:121930487-121930509 ACCCTTTATGGGCTGGGGGACGG + Intergenic
1075731382 10:124638734-124638756 GCCCTTCAGGGGCGAGGACAAGG + Intronic
1076190302 10:128478613-128478635 CTCGTTCCGGGGCTGGGTGATGG + Intergenic
1076812080 10:132892000-132892022 GACCTCCAGGGGCTGTGTCACGG + Intronic
1077037464 11:502382-502404 GCCTTTCTGGGGGTGGGTGCTGG - Exonic
1077366805 11:2164546-2164568 CCTCTTCCAGGGCTGGGTGAGGG + Intronic
1077405075 11:2379170-2379192 GGGCTTCAGGGGCTGGCAGAGGG - Intronic
1077528503 11:3083607-3083629 GCCCTGGAGGGGCTGGGGAAGGG - Intergenic
1078136687 11:8657728-8657750 AGCCTTCAGGGGCTGTGTGGTGG - Intronic
1080489978 11:32751644-32751666 CCACTGCAGGGGCTGGGGGAGGG + Intronic
1081441829 11:43089349-43089371 GCTCCTCGGGGGCAGGGTGAGGG + Intergenic
1081660561 11:44885573-44885595 GTGCTTCAGGGGTTGGGGGAGGG - Intronic
1081929439 11:46858543-46858565 GCCCATCAGGGGCTGGGACATGG - Exonic
1083595503 11:63916825-63916847 GCCGTTCAGCGGCTGGGCGCTGG + Exonic
1083639942 11:64140092-64140114 GGCCTTCAGGGGTGGGGTGGAGG - Intronic
1083777796 11:64902678-64902700 GCTCTGCAGGGGCGGGGTGGGGG + Exonic
1083940287 11:65891820-65891842 CCACTTCAGGGGCTGGATTAAGG - Intergenic
1084192461 11:67505208-67505230 GCCCTGCCCGGGCTGGGTGAGGG - Exonic
1084275382 11:68048736-68048758 GCCCCTCGGTGGGTGGGTGATGG + Intronic
1084731142 11:71074398-71074420 GCCTTTGAGGAGCTGGGGGAGGG - Intronic
1084778900 11:71396145-71396167 GGCCTGCTGGGGCTGGGTGCGGG + Intergenic
1084903608 11:72328896-72328918 TCCCCTCAGAGGCTGAGTGAAGG + Intronic
1085232179 11:74981787-74981809 GCCTTTCATGGGCTGGATTAGGG + Intergenic
1085232361 11:74983132-74983154 GCCTTTCACGGGCTGGTTTAGGG + Intergenic
1085525536 11:77161488-77161510 GCCTTTTAGGGGCCGTGTGAGGG + Intronic
1086822578 11:91452652-91452674 GGCCTTTATGGGGTGGGTGAAGG + Intergenic
1088678860 11:112222157-112222179 GACCTGAAGGGGCTGGGTGTGGG - Intronic
1089006335 11:115094547-115094569 GACCTACATGGGCTGAGTGAGGG - Intergenic
1089491341 11:118886021-118886043 GCCCTTCAGTGAGTGGGTGGGGG - Intronic
1089789404 11:120931919-120931941 GCTTTTCAGGGGCTGTGGGAAGG - Intronic
1090580586 11:128154273-128154295 ACCCTTCCGGGGGTGTGTGAAGG - Intergenic
1090883511 11:130855711-130855733 GCCTGTCAGGGGCTGGGGGAGGG - Intergenic
1091694831 12:2621459-2621481 GCCCTTCAGGATCACGGTGAGGG + Intronic
1092491466 12:8949535-8949557 ACCCTTCTGGGGATGGGAGACGG + Exonic
1096636131 12:52960735-52960757 GGCCTTCAGTGGCAGGGTGCAGG - Intergenic
1096673650 12:53214856-53214878 ACCCTGCAGGAGCTGGGGGAGGG + Intronic
1097399154 12:59108611-59108633 TCCCTTTACGGGCTGGGGGACGG - Intergenic
1099544171 12:83955734-83955756 GACCTTCTGAGGCTGTGTGATGG + Intergenic
1100408414 12:94291063-94291085 GCCCATCAGGGTGTGGGGGAGGG + Intronic
1102375710 12:112419271-112419293 GCCCTCCAGGGGCCGGGGGCCGG + Intronic
1103279078 12:119739868-119739890 GCTCTTTGGGGGCTGGGTGAGGG - Intronic
1103822500 12:123710327-123710349 GCCCTAGAGGGGTCGGGTGAAGG - Intergenic
1103862490 12:124025960-124025982 GCCCTTCAGGGCCTTGGTTAGGG + Intronic
1104640841 12:130465880-130465902 TCCCTGCAGGTGCTGGGTGGGGG - Intronic
1106219262 13:27731885-27731907 GCCTTTCTGGCGCTGGGGGAGGG - Intergenic
1108552057 13:51556360-51556382 GCCCTTTAGGAGCTGGGTAGTGG + Intergenic
1111561420 13:89954054-89954076 GGTTTTCAGGGGCTGGGTGGTGG - Intergenic
1111562326 13:89967463-89967485 TGCCTTCAGGAGCTGGGTGTGGG - Intergenic
1112271748 13:97976026-97976048 GCCTTCCTGGGGGTGGGTGAAGG + Intronic
1112966668 13:105205102-105205124 GGCTGTCAGGAGCTGGGTGAAGG + Intergenic
1116634993 14:47383196-47383218 GCCTGTCAGGGGATGGGGGAGGG + Intronic
1116992714 14:51292759-51292781 GGTCATCAGGGGCTGGGGGACGG - Intergenic
1117107003 14:52407907-52407929 CCCCTTCAGGGGATGGGGCAAGG + Intergenic
1117516313 14:56505298-56505320 GTCTTTCAGGGGCTGGTGGAGGG + Intronic
1117723116 14:58646391-58646413 GCCCTCCAGGGGCTGGAGAACGG + Exonic
1118381048 14:65217694-65217716 GCCCTTCAGGTTCTAGGTAAGGG - Intergenic
1118814177 14:69298304-69298326 GCCCTCCAGGGGCAGAGAGAGGG - Intronic
1119668169 14:76499312-76499334 GCCCTTCAGGGAGAGGGGGAAGG - Intronic
1120199659 14:81523227-81523249 GCCCTTCTGAGGTTGGGGGATGG - Intronic
1120525822 14:85575771-85575793 GGGCTTCAGGAGCTGGGTGAAGG - Intronic
1121320747 14:92990337-92990359 GCCCATCTGGTCCTGGGTGATGG - Intronic
1121328759 14:93036627-93036649 GCACCCCAGGGGCCGGGTGAGGG + Intronic
1121405129 14:93715262-93715284 GCCCTCCAGGGGTAGGGTGGTGG - Intergenic
1121775961 14:96591034-96591056 GCCCTGCAGGCCCTGGGTGTGGG + Intergenic
1122020550 14:98834450-98834472 GCCCTTCAGTTGCTGGATGGTGG + Intergenic
1122023801 14:98859971-98859993 GCCCATCAGAGGCTGACTGAGGG + Intergenic
1122098173 14:99386621-99386643 TCCCTTCAGGGGCCGGGGGTAGG - Intergenic
1122302415 14:100738684-100738706 GGCCTTCCGGGGCTTAGTGAAGG + Intergenic
1122349077 14:101077368-101077390 GCCCTTCTGAGGGTGGGTGGGGG + Intergenic
1122406820 14:101505704-101505726 GCCCTTCCGGGGGTGGGTGAGGG + Intergenic
1122959131 14:105086657-105086679 GCCCATCAGAGGCAGGGTGCAGG + Intergenic
1123030196 14:105447956-105447978 CCCCAGCAGGGGCTGGGTGGAGG - Intronic
1127323777 15:57873975-57873997 GGTTTTCAGGGGCTGGGTTATGG + Intergenic
1127963759 15:63908744-63908766 TCCATCCAGGGGCTGGGGGATGG + Intronic
1128243251 15:66115873-66115895 TTCCTTCCGGGGCTGGGCGAAGG - Intronic
1128611345 15:69076022-69076044 GGACTTCAGGGGCTGGTTGTAGG + Intergenic
1128671794 15:69579234-69579256 TCACTTCAGGGGCTGGGGGGTGG - Intergenic
1129340425 15:74882294-74882316 TCCCTCCAGGGGCTGAGTGCAGG - Intergenic
1129382072 15:75174297-75174319 TCCCTTGAGGGCCTGGGTGGGGG + Intergenic
1129457698 15:75684360-75684382 GGCCTTCACTTGCTGGGTGAAGG + Intronic
1129468566 15:75738003-75738025 GCTCCCCAGGGGCTGGGAGAGGG + Intergenic
1129944153 15:79524617-79524639 CCCCTTCTGGGTCTGGGTCAAGG + Intergenic
1130411861 15:83654305-83654327 GCCCCTCAGGGGTCGGGGGAAGG + Intronic
1131456494 15:92586147-92586169 CCCCTGCAGAGGCTGGGGGAAGG + Intergenic
1132338978 15:101066142-101066164 GGCCTGCAGGTGCTGGCTGAAGG - Exonic
1132383140 15:101380403-101380425 GACCCTCAGAGGCTAGGTGAGGG - Intronic
1132756808 16:1489304-1489326 GCCGTGCACGGCCTGGGTGATGG - Intergenic
1133820384 16:9231181-9231203 GCCCTTCAGGGGCTTGGAGATGG + Intergenic
1134557913 16:15182160-15182182 GGCCTGCTAGGGCTGGGTGAGGG - Intergenic
1134918449 16:18093763-18093785 GGCCTGCTAGGGCTGGGTGAGGG - Intergenic
1135435844 16:22426133-22426155 GGCTTTCCGGGGCTGGGTGGAGG - Intronic
1135984983 16:27177583-27177605 GCCTTTCTGGGGTTGGGTGTTGG + Intergenic
1136294705 16:29294993-29295015 GCCATGCAGGGGCTGGGTGAGGG + Intergenic
1136587751 16:31198582-31198604 GCCCTTCAGGTGTTAGGGGAAGG + Intergenic
1137729183 16:50677403-50677425 GCCCGTCAGGTCCTGGGTGCGGG + Exonic
1139530368 16:67539708-67539730 GCCCTGCAGGGGTGGGGAGAAGG - Exonic
1141280577 16:82627192-82627214 GCCCGGCACGGGCAGGGTGAGGG + Intronic
1141814678 16:86401481-86401503 CCCTCTCAGGGGCTGGTTGAAGG + Intergenic
1141920876 16:87134546-87134568 CCCCTTCAGGGGCTGGAGGAGGG + Intronic
1142009402 16:87706258-87706280 GCCCTTGAGGGGGTCGGTGGCGG + Intronic
1142045053 16:87919963-87919985 GGCTTTCCGGGGCTGGGTGGAGG - Intronic
1142100607 16:88269037-88269059 GCCATGCAGGGCCTGGGTGAGGG + Intergenic
1142155320 16:88530281-88530303 GCCCCTCAGGGACTGGGAGGTGG - Intronic
1142467184 17:142706-142728 CCCCTTCAGGGTCAGGGTCAGGG - Intergenic
1142492164 17:286242-286264 GCCCTCCAGAGGTTGGGTGAAGG + Intronic
1142997712 17:3770767-3770789 GTCCACCAGGGGCTGGGGGAGGG - Intronic
1143524893 17:7466260-7466282 CGCCTTCAGGGCCTGGGGGAGGG - Exonic
1144466993 17:15504898-15504920 GACCTTCAGGGGCTTCTTGAGGG + Intronic
1144753824 17:17667823-17667845 GCCCTCCAGGGCCTGTGGGATGG - Intergenic
1145018020 17:19411509-19411531 GCCCTCCTTGGGCTGGGGGATGG + Intronic
1145398974 17:22516193-22516215 GCCCTGGGGGAGCTGGGTGAAGG - Intergenic
1145939960 17:28738075-28738097 GGCCTGCAGGGGCAGGGGGATGG - Exonic
1146255014 17:31387044-31387066 GCCCTTCAGAGGCTCTGGGAGGG + Intergenic
1147051713 17:37800080-37800102 GCCCATCAGGGCCTGTGAGAAGG + Intergenic
1147114442 17:38288489-38288511 GCTCTCCTGTGGCTGGGTGAAGG - Intergenic
1147543534 17:41380864-41380886 ATTCTTCAGCGGCTGGGTGAGGG - Intronic
1147970763 17:44218472-44218494 GGGCTGCAGGGGCTGGGGGAGGG - Intronic
1148124315 17:45229090-45229112 GCCCTTGGAGGGCTGGGGGAGGG + Intronic
1148415167 17:47500710-47500732 GCTCTCCTGTGGCTGGGTGAAGG + Intergenic
1148960275 17:51386647-51386669 GCCCTTATCGGGCTGGGTGAAGG + Intergenic
1149246991 17:54720920-54720942 GCCTATCAGGGGGTGGGGGAAGG + Intergenic
1150284446 17:63947165-63947187 GACCTGCAGGGGAGGGGTGAGGG + Exonic
1150939002 17:69669784-69669806 GCCCTTCAGGGGGTGGTTTTTGG + Intergenic
1151441331 17:74131124-74131146 ACCTCTCAGGAGCTGGGTGAGGG - Intergenic
1151967188 17:77437551-77437573 GCCCCTCAGGGACCAGGTGAGGG + Intronic
1152008161 17:77695261-77695283 GCCCCTCAGTGGGAGGGTGATGG - Intergenic
1152028742 17:77828346-77828368 GGCCTCCAGAGGCTGAGTGAGGG - Intergenic
1152275889 17:79356899-79356921 GCCCGACAGGAGCTGGCTGAGGG - Intronic
1152566619 17:81103213-81103235 GCCCATCAGGGCCTGGAGGAAGG - Intronic
1152618151 17:81347080-81347102 GCCCTACAGGGCCTGACTGAGGG - Intergenic
1152747594 17:82048554-82048576 GCCCACCAGGGGCTGGGAGAGGG + Exonic
1152908466 17:82983594-82983616 GCCGTTCAGATGCTGGGGGAAGG + Intronic
1152923159 17:83075982-83076004 GCCCTCATGGGGCTGGGTGGGGG - Intergenic
1152986600 18:327109-327131 TCCAGTCAGGGGCTGGGTGTTGG + Intronic
1153771820 18:8422848-8422870 GGCCACCAGGGGCTGGGGGATGG + Intergenic
1154122441 18:11662943-11662965 GCCCATCAGGGGCAGTGTGAGGG + Intergenic
1157750505 18:50174026-50174048 GCCCTTAATGGATTGGGTGATGG - Intronic
1159452617 18:68621576-68621598 GCCTGTCAGGGGCTGGGAGGAGG + Intergenic
1159472130 18:68870187-68870209 GCCTGTCAGGGGGTGGGTGGGGG + Intronic
1159574968 18:70164046-70164068 GGCTGTCAGGGGCTGGGAGAAGG + Intronic
1160739464 19:679315-679337 GCCCTGCAAGGGCTGCGTGGCGG + Intronic
1160797656 19:953309-953331 GCCCTTCCAGGGCTGGGGGGTGG + Intronic
1160898272 19:1413043-1413065 GCCCCTCAGAGGCAGGGTGCAGG + Intronic
1160935391 19:1592295-1592317 GCCGTTCAGGGACTGGCTGCCGG - Intronic
1160984839 19:1833762-1833784 GGGCTTCCGGGGCTGGGGGAGGG - Intronic
1162030940 19:7916979-7917001 GCCCTTCGGGGGCTGGGCACGGG + Intronic
1162765779 19:12918548-12918570 GACCTAGAGGGGCCGGGTGAGGG + Intronic
1162842093 19:13364100-13364122 ACCCTTCAGTGGCTGGGTCTGGG - Intronic
1162860971 19:13505795-13505817 GTCTTCCAGGGGCTGGGAGAGGG - Intronic
1163084292 19:14968377-14968399 GCCCTTCCCGGGATGGATGATGG + Exonic
1163665971 19:18604246-18604268 GCCCTCCCGGGGCTGGGCGGGGG + Intronic
1163696159 19:18764568-18764590 GGCCTTCGGGGCCGGGGTGAGGG + Intronic
1164199275 19:23003278-23003300 CCCCTTCAGGCCCTGAGTGACGG + Intergenic
1164455444 19:28403064-28403086 CCTCTTCAGGGGCTCGGTGGGGG - Intergenic
1164523897 19:28999690-28999712 GGCCTTCAGTGGCAGGGTGGTGG - Intergenic
1164945329 19:32288474-32288496 TCCCTCCAGGGCCTGGGTTAAGG - Intergenic
1165534055 19:36428625-36428647 GGCCCTCAGGGGCTGGGGCAGGG + Intergenic
1166232222 19:41431535-41431557 GTGCTTCAGGAGCTGGGTGCTGG + Intronic
1166636486 19:44456214-44456236 GCTCTTCTGCGGCTGGGTGTGGG + Intergenic
1166947689 19:46407103-46407125 GCCCTGCAGGTGCTGTTTGAAGG + Intergenic
1167022684 19:46889951-46889973 ACCCTTAAGGGGTTGGGTCAGGG + Intergenic
1167051974 19:47084937-47084959 GCCCTTTGGGGGGTGGCTGATGG + Intronic
925969272 2:9095715-9095737 GCCCGACAGGGGCAGGGTGGTGG - Intergenic
926523358 2:13945466-13945488 GACCTCCAGGAGCTGGGTGCCGG - Intergenic
927574394 2:24189512-24189534 GCCCTCAAGGGGCTTGCTGATGG - Intronic
928103334 2:28452228-28452250 GCCCTCCAGGGGGTAGGTGTGGG - Intergenic
928361412 2:30665011-30665033 GTCCTTCAGGGGCACGGCGATGG + Intergenic
928915373 2:36464756-36464778 TACCTTCAGGGGCTTGCTGAAGG + Intronic
929761981 2:44814516-44814538 GCCATGCAGGGGGTGGGGGAAGG + Intergenic
931762754 2:65431909-65431931 GCCCCTCAGGGGCAGCGTGGGGG - Intronic
931867057 2:66425003-66425025 TCCCTGAAGGGGCTCGGTGATGG + Intergenic
932578230 2:72974434-72974456 GTCCTGGAGGGGCTGGATGAGGG - Intronic
934025086 2:87995872-87995894 GCCCTTCAAGGGAGGGGTTAAGG + Intergenic
934060567 2:88288690-88288712 GTCCATCAGGGATTGGGTGATGG + Intergenic
936116576 2:109707606-109707628 TCCCTTCAGTGGCTGGGTCATGG - Intergenic
937225905 2:120368552-120368574 GCCAGGCAGTGGCTGGGTGAGGG + Intergenic
937970602 2:127546114-127546136 GGGCATCTGGGGCTGGGTGAGGG - Intronic
938052814 2:128190660-128190682 GCCCGTCAGGGTCAGGGTCAGGG + Exonic
938140389 2:128790230-128790252 GGCCTTCAGGGGCAGGAGGAGGG + Intergenic
938236417 2:129709990-129710012 GGCCTCCAGGGGCCGCGTGAGGG - Intergenic
938541318 2:132286268-132286290 GCTCTTCTGCGGCTGGGTGTGGG + Intergenic
940699991 2:157028604-157028626 GCCTGTCAGGGGGTGGGTGGGGG + Intergenic
941842601 2:170103036-170103058 GCCTGTCAGGGGCTGGGGGGAGG - Intergenic
944063133 2:195590735-195590757 GCACATCAGGGGATGGGAGAAGG + Intronic
944543399 2:200775867-200775889 GGCCTTCATGGACTGGGAGAAGG + Intergenic
945605080 2:211919036-211919058 GACCTCCATGGGCTGGGGGAGGG - Intronic
946405918 2:219492046-219492068 GTCCTTCTGGGTCTGGGTGTTGG + Intronic
947360700 2:229342573-229342595 GCCCTCCAGTGGCTGGGAGCTGG - Intergenic
948307165 2:236956877-236956899 GCCCCTCAGGGACTGGTGGATGG - Intergenic
948335213 2:237202089-237202111 GCCCTTCTGGGGGTGGGGTAGGG + Intergenic
948353045 2:237356549-237356571 GCCCCTCAGGGCGTGGCTGAGGG + Intronic
948932721 2:241142309-241142331 GCCTTTCAGGGGCTGTCTGATGG - Intronic
1169227572 20:3865945-3865967 GCCCTCCAGGAGCTGGATGCTGG - Exonic
1169317952 20:4608973-4608995 GCCCCTCAGAGGTTGGATGAGGG - Intergenic
1170783762 20:19449805-19449827 GCCCTTCAAGGGCTGGGGTTTGG - Intronic
1171462913 20:25308944-25308966 GCCATTCAGGTGTTGGGAGAAGG + Intronic
1172229898 20:33329738-33329760 GCTGTTCAGGGGCTGCCTGATGG + Intergenic
1173660437 20:44729518-44729540 GCCATGCAGGGGCTCTGTGAAGG - Intergenic
1174298634 20:49567102-49567124 AGACTTCAGGGGCTGGGGGAGGG + Intronic
1174663360 20:52234992-52235014 GCCCTTCAGGAGATAGGTGTGGG + Intergenic
1174698103 20:52580609-52580631 GCCTTACAGGAACTGGGTGAGGG - Intergenic
1175232745 20:57484286-57484308 GGTCTCCAGGGGCTGGGTGGAGG + Intergenic
1175251926 20:57615139-57615161 GGCCTTGAGGGGCTGGGTCCAGG - Intronic
1175870908 20:62208967-62208989 CCCCCTCAGGGGCTGGAAGAAGG - Intergenic
1175958558 20:62623592-62623614 TCCCTAAAGGGGCTGGGGGAGGG + Intergenic
1176099567 20:63358804-63358826 GCCCTGGAGGGGCCGGGTAAGGG - Intronic
1176144237 20:63558418-63558440 GTCCTTCAGGGGCTGCTGGAGGG - Intronic
1176170100 20:63692893-63692915 GTCCTGCAGGGCCTGGGTGAAGG - Exonic
1176228132 20:64015307-64015329 GCCCCTGAGGGTCTGGGTGCTGG + Intronic
1176292625 21:5054261-5054283 CCCCTTCAGGGTCTGGAAGAGGG - Intergenic
1178465047 21:32840380-32840402 GCTCTTCAGGGGCAGGGCCAGGG + Intergenic
1179138172 21:38698986-38699008 CACCTTCTGGGGGTGGGTGAGGG + Intergenic
1179864635 21:44209389-44209411 CCCCTTCAGGGTCTGGAAGAGGG + Intergenic
1179890157 21:44331181-44331203 GGGCTTCAGGGGCAGGGTGGGGG + Intronic
1179987671 21:44930517-44930539 GCACTGCAGGGGCAGGGTGGGGG + Intronic
1180089887 21:45528491-45528513 GCCCGTCAGGGGCTCAGGGAGGG + Intronic
1181874584 22:25930192-25930214 GTCCTCCATGGGCTGGGTGAGGG + Intronic
1183033110 22:35120234-35120256 GCCCTCCAGGGGCTGGGTCCGGG - Intergenic
1183591446 22:38781433-38781455 GCCCTCCAGGAGCTGGGAGGAGG - Intronic
1183664457 22:39239386-39239408 GCCCTTCCGGGGCTGGGGGTGGG + Intronic
1183698255 22:39435450-39435472 GCCCTTCAGGGGCTGGGTGAGGG - Intronic
1183966755 22:41446880-41446902 GCCCTGCAGGGGCGGGGCCAGGG + Exonic
1184429310 22:44431965-44431987 GCTGTGCAGGTGCTGGGTGAGGG - Intergenic
1184506383 22:44906349-44906371 GCCATCCAGGGGCAGGGAGACGG + Intronic
1184518716 22:44979475-44979497 GCCCTCCAGGGGCTGCAGGAAGG - Intronic
1184747564 22:46465125-46465147 GACGTTCAGGGGGTGGGTCATGG + Intronic
1185342505 22:50297999-50298021 GTCCCTCAGGGGCTGGGTTAGGG - Intronic
949485996 3:4538868-4538890 GCCTTTTAGGGGATGGGTGAGGG + Intronic
949545581 3:5069351-5069373 GTCCTTCAGGGGCGAGGAGATGG - Intergenic
950014206 3:9744519-9744541 TCTCTTGGGGGGCTGGGTGATGG - Intronic
950203343 3:11060052-11060074 GGTTTCCAGGGGCTGGGTGAGGG + Intergenic
950966745 3:17152051-17152073 GCCATTCAGGTGCTGGGGGAGGG + Intergenic
952763396 3:36934972-36934994 GCCATGCTGGAGCTGGGTGAGGG - Intronic
954294204 3:49665121-49665143 GCCCTGCAGGGGATGGCAGATGG - Intronic
956456029 3:69421173-69421195 GCACCTCTGGGGCTGTGTGAGGG - Intronic
960497678 3:118394813-118394835 GCCCTGCAGAGGTGGGGTGAGGG + Intergenic
961391642 3:126555800-126555822 GCCCTGGAGGGGCAGGGTTATGG - Intronic
961504827 3:127363032-127363054 CACCTTCCGGGGCTGGGTGGGGG - Intergenic
961824034 3:129589453-129589475 GGCCTTCAGGGGCTGCAGGATGG + Exonic
963123979 3:141798262-141798284 GCCCCTGAGGGGATGGGGGAGGG + Intronic
963751690 3:149186404-149186426 GCACTTCAGAGGCTTGGGGAAGG + Intronic
963939623 3:151086066-151086088 TCCCTCCAGGGGCTGGGGAAGGG - Intronic
967975565 3:195032638-195032660 ACCCTTCAGTGGCTGGATGGTGG - Intergenic
968483953 4:849840-849862 GGCCTTCAGGGGCGGGGCGGGGG - Intronic
968501320 4:951531-951553 GCCCTGCAGGGTCTGGGGGCTGG + Intronic
969381728 4:6804258-6804280 GCACTCCAGGGGCTGGTGGAGGG - Intronic
970128486 4:12841171-12841193 GCCTGTCGGGGGGTGGGTGAGGG + Intergenic
970318787 4:14855359-14855381 GGTCTTCAGGGACTGGGTCAAGG - Intergenic
970375706 4:15455173-15455195 GCCCTCCAGGGCCTTGGTGGAGG + Intergenic
972943933 4:44229968-44229990 GCCTGTCAGGGGGTGGGGGAGGG - Intronic
975622385 4:76307436-76307458 GCTCTTCATGGGCTGTGCGATGG - Intronic
976095753 4:81506737-81506759 GCCCTTCTGAGGCTGGGGGTGGG - Intronic
978761452 4:112358828-112358850 GTCCTGCAGGGCCTGGGTGAAGG - Intronic
980890485 4:138809734-138809756 ACCCCTCTGGGGCTGGGGGAAGG - Intergenic
981688440 4:147480899-147480921 GCCCTTCAGGGCCTGGAAGGGGG + Intronic
984762823 4:183377148-183377170 GCATTTCAGGGACTGGGTAATGG + Intergenic
985109937 4:186538467-186538489 GCCCTGCAGGGGGTGGGTGACGG + Intronic
985671416 5:1208860-1208882 GCCCTTCAGGGCCGGGTGGATGG - Exonic
985767671 5:1788368-1788390 GCCCTCCAGGACCTGGGTAATGG - Intergenic
986223728 5:5793764-5793786 GACCTTCAGGACCTTGGTGAAGG - Intergenic
988219009 5:28317254-28317276 GCCTGTCAGGGGATGGGTGGGGG - Intergenic
990618358 5:57531049-57531071 GCCTGTCGGGGGCTGGGGGAGGG + Intergenic
992390827 5:76329263-76329285 GCCCTTTTCTGGCTGGGTGATGG - Exonic
992743016 5:79792820-79792842 GCCCTTAAGAGGTTGGTTGAAGG - Intronic
995028919 5:107457333-107457355 GACCTTCAGAGGCTGAGTCAAGG - Intronic
997228879 5:132228562-132228584 GCCCATCAAAGGCTGGGTGGGGG + Intronic
997235139 5:132268264-132268286 GCCCTGCAGGGGTGGGGTGGGGG - Intronic
997597082 5:135114214-135114236 GACCTTGAGGGGCTGTGAGAAGG + Intronic
997645026 5:135476396-135476418 GCACTTCAGGGGCCGTCTGATGG + Intergenic
997979025 5:138457672-138457694 GCACTTCAGGGGGTGGGAGCTGG + Intergenic
998415588 5:141944139-141944161 GCCTTCCAGGGGATGGGGGAGGG - Exonic
998945589 5:147336354-147336376 GCACTTCAGTTGCTGGGTCAAGG - Intronic
999198128 5:149796749-149796771 GCTCCTCAGCAGCTGGGTGAAGG + Intronic
999269243 5:150286769-150286791 GCCCATCCGGGGCTGGGAGGAGG - Intronic
999768237 5:154756252-154756274 GCCCTGGAGGTGCTGGGGGAGGG - Intronic
1002048067 5:176553121-176553143 GCGCCTCGGGGACTGGGTGAAGG + Intronic
1002185034 5:177450404-177450426 GCCAGGCGGGGGCTGGGTGATGG + Intronic
1002460207 5:179369555-179369577 GCCGTTCCTGGGCTGGGGGAGGG + Intergenic
1003822392 6:9913574-9913596 GCCCGTCGAGGGCGGGGTGAGGG - Intronic
1005597428 6:27392605-27392627 GCCTTTCAGGGACTGGGTCTGGG + Intronic
1006026241 6:31148826-31148848 GCCATGCAGGGGCTGGGGGGAGG + Intronic
1006364408 6:33606943-33606965 TCCCTTCAGGGCCTGGGTGCTGG - Intergenic
1008570908 6:52815613-52815635 GTCCCTCAGGGGCTGCCTGAGGG - Intergenic
1008752964 6:54758546-54758568 GTGCTTCAGGGGATGGGGGAGGG + Intergenic
1012079096 6:94733263-94733285 GCCTGTAGGGGGCTGGGTGAGGG - Intergenic
1013048759 6:106512109-106512131 GCCCTTGGGGGGCTGGCTGCGGG - Exonic
1014145541 6:117994158-117994180 GGCCTTCAGGAGCTGAGAGAGGG - Intronic
1014290372 6:119551287-119551309 GCCCTTCAGGGTCTGGCTCCTGG + Intergenic
1015923980 6:138291801-138291823 GGCCTTCTGGGGCTGGCTGATGG - Exonic
1016225523 6:141730423-141730445 GGCCTGCAGGGGTTGGGTAAGGG - Intergenic
1018358050 6:163038439-163038461 GCCCTTCACTGGCTGTGTGCAGG - Intronic
1018694633 6:166382392-166382414 CCCCTTCAGGGAGTGGGTGACGG - Intronic
1019468601 7:1204852-1204874 GCCCCTCCTGGGCTGTGTGAGGG + Intergenic
1019739250 7:2664603-2664625 GCCCTACAGAGGCTGGAGGAGGG - Exonic
1020136645 7:5591788-5591810 TCCCTAGAGGGGGTGGGTGAGGG + Intergenic
1020934877 7:14450482-14450504 GCCCTACAGTGGCTGAGTGGAGG + Intronic
1022535505 7:31095942-31095964 GGGCATCAGGGGCTGGGTCAGGG + Intronic
1023039474 7:36159815-36159837 ACACTTGAGGGGCTGGGTGGAGG - Intronic
1026322167 7:69277442-69277464 GGCCTCCAAGGGCTCGGTGAGGG - Intergenic
1026447777 7:70500553-70500575 TCCATTCAGGGGCGGGATGAAGG + Intronic
1027131215 7:75592574-75592596 CCCCTGCAGTGGCTGGGTGCAGG - Intronic
1028638329 7:93015985-93016007 GCCCTTTTGGGGTTGGTTGATGG - Intergenic
1029275811 7:99403743-99403765 GGCCTTCTGTGGCTGTGTGAGGG - Intronic
1030091972 7:105865850-105865872 GGTATTCAGGGGCTGGGGGAGGG - Intronic
1030370415 7:108693731-108693753 TCCCTTCAGGGAATGGATGATGG + Intergenic
1030884522 7:114922102-114922124 GCCCTCCCGGGGCTGGGAAAGGG - Intergenic
1032708361 7:134441524-134441546 GCCCCTCCAGCGCTGGGTGAGGG + Intergenic
1034434010 7:151054509-151054531 CATCTTCAGGGGCAGGGTGAGGG + Intronic
1034496705 7:151427542-151427564 GCCTTGCTGGGGCTGGGGGATGG - Intergenic
1034560819 7:151878025-151878047 GCCCTAGAGGGGTTGGGGGAGGG + Intergenic
1035637507 8:1157479-1157501 GGTCTTCAGGGGCTGGGAGATGG - Intergenic
1036035128 8:5010301-5010323 GCCTGTCAGGGGTTGGGTGGGGG + Intergenic
1036602388 8:10273980-10274002 ACCCTGCAGGGGCCTGGTGAAGG + Intronic
1037835866 8:22214394-22214416 GCCCCTCAGGAGCTGGCTGCAGG + Intergenic
1037892930 8:22633382-22633404 TCCCTGCAGGGACTGGGAGAGGG + Intronic
1039216873 8:35281652-35281674 GCCTTTTATGGGCTGTGTGATGG + Intronic
1041300177 8:56403427-56403449 GCATTTCAGTGGCTGGGTTAGGG + Intergenic
1042591471 8:70402699-70402721 TCCCTTCAGGGGCGGAGAGAAGG + Intronic
1044316055 8:90751186-90751208 GTCTTTCAGGGGCTGGACGAGGG + Intronic
1045649619 8:104329740-104329762 GCGGGTCAGGGGCTGGGTGGGGG + Intergenic
1047711350 8:127555643-127555665 GCCTGTCATGGGGTGGGTGAGGG + Intergenic
1048378719 8:133845406-133845428 GCCCAACAGGTGCTGGCTGAGGG - Intergenic
1048608809 8:135999653-135999675 GACCATCAGAGGCTGGGGGAAGG - Intergenic
1049398896 8:142416050-142416072 GCCCTCCAGTGCCTGGGTCAAGG - Intergenic
1049472713 8:142783485-142783507 GCCCTGCAGTGGCTGGGAGGGGG + Intergenic
1049615068 8:143572429-143572451 GCCCCTCAGGGGCTGGTTCCAGG + Exonic
1055642696 9:78332732-78332754 GCCTTGCAGAGGCTGGGAGAGGG + Intergenic
1056687171 9:88776249-88776271 GCCCCTCAGGGGCTGGATGGGGG + Intergenic
1056706373 9:88955503-88955525 CCCGTTCAGGGGCTGTTTGAGGG + Intergenic
1056964797 9:91156665-91156687 GTCCTTTAGGTGCCGGGTGAAGG - Intergenic
1056969904 9:91193229-91193251 GCCCGTAGGGGGCAGGGTGAGGG + Intergenic
1057354208 9:94321411-94321433 GCTCTGCAGGGGCCGGGTGAGGG - Intronic
1057653556 9:96936224-96936246 GCTCTGCAGGGGCCGGGTGAGGG + Intronic
1057821309 9:98333185-98333207 GCTCTCCAGGTGCTGGGTGTGGG + Intronic
1058484546 9:105430438-105430460 GGTTTCCAGGGGCTGGGTGAGGG - Intronic
1059961086 9:119565083-119565105 GACCTTCATGTGCTGGGTGATGG - Intergenic
1060740172 9:126092592-126092614 GCAGTGCTGGGGCTGGGTGAGGG + Intergenic
1061028732 9:128067184-128067206 CCCCTGTAGGGGGTGGGTGAGGG - Exonic
1061485828 9:130920061-130920083 GCCTTTCAGGGCCTGGGGAATGG - Intronic
1062000951 9:134215400-134215422 CCCCTGGAGGGGCTGGGGGAAGG + Intergenic
1062555741 9:137112718-137112740 GCCCATCTGGGGCCGGGGGAAGG + Intronic
1203568056 Un_KI270744v1:108450-108472 GCTCTTCTGTGGCTGGGTGTGGG + Intergenic
1185979702 X:4764017-4764039 GCCCTTCATTGGCTGGGCTATGG + Intergenic
1186350196 X:8732201-8732223 GCCCTCGAGGGGTGGGGTGAGGG + Intergenic
1188824748 X:34818099-34818121 GCCTGTCAGGGGTTGGGGGAGGG - Intergenic
1189318542 X:40073350-40073372 TGCCCTCAGGGGCTGGGTAAGGG + Exonic
1189599660 X:42609563-42609585 GCCTGTCAGGGGATGGGGGAAGG + Intergenic
1189833769 X:45000712-45000734 GGCCCTCGGGGGCTGGGAGATGG + Intronic
1190384832 X:49875047-49875069 GGGCTTCAGGGGCGGGGAGATGG - Intergenic
1190735064 X:53250616-53250638 GGCCTTCAGGGGCTGGGTAGTGG + Exonic
1192215761 X:69156991-69157013 GGCCTTCAGAGGCTGGGGGTGGG + Intergenic
1192390395 X:70720361-70720383 GCCTTTCATGGGGTGGGAGAAGG + Intronic
1193488447 X:82116244-82116266 CCACTTCTGGGGCTGGGGGAGGG + Intergenic
1194891690 X:99386378-99386400 GGTTTTCAGGGGCTGGGGGAAGG - Intergenic
1195114453 X:101682909-101682931 GCCCTGATGGGGCTGGGGGAAGG - Intergenic
1198522202 X:137464488-137464510 GCCCCTCAGGGGCTGGGGAGAGG + Intergenic
1200083049 X:153588872-153588894 GCTCCCCAGGGGCTGGGTTAGGG - Intronic