ID: 1183700429

View in Genome Browser
Species Human (GRCh38)
Location 22:39448132-39448154
Sequence CAGGCTGTCCAGCTGGACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183700429_1183700433 -9 Left 1183700429 22:39448132-39448154 CCCAGGTCCAGCTGGACAGCCTG No data
Right 1183700433 22:39448146-39448168 GACAGCCTGGACCCCTGAACAGG No data
1183700429_1183700434 -8 Left 1183700429 22:39448132-39448154 CCCAGGTCCAGCTGGACAGCCTG No data
Right 1183700434 22:39448147-39448169 ACAGCCTGGACCCCTGAACAGGG No data
1183700429_1183700442 27 Left 1183700429 22:39448132-39448154 CCCAGGTCCAGCTGGACAGCCTG No data
Right 1183700442 22:39448182-39448204 CCCTGGTTTATTTAAGTTTCAGG No data
1183700429_1183700439 10 Left 1183700429 22:39448132-39448154 CCCAGGTCCAGCTGGACAGCCTG No data
Right 1183700439 22:39448165-39448187 CAGGGCTTCCAGCAGCACCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183700429 Original CRISPR CAGGCTGTCCAGCTGGACCT GGG (reversed) Intergenic
No off target data available for this crispr