ID: 1183702108

View in Genome Browser
Species Human (GRCh38)
Location 22:39456856-39456878
Sequence CCGTCCACGCATACACAGAA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183702103_1183702108 4 Left 1183702103 22:39456829-39456851 CCGACCCGGGCACGCTGCGGAAC No data
Right 1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG No data
1183702105_1183702108 -1 Left 1183702105 22:39456834-39456856 CCGGGCACGCTGCGGAACGCACC No data
Right 1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG No data
1183702104_1183702108 0 Left 1183702104 22:39456833-39456855 CCCGGGCACGCTGCGGAACGCAC No data
Right 1183702108 22:39456856-39456878 CCGTCCACGCATACACAGAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183702108 Original CRISPR CCGTCCACGCATACACAGAA CGG Intergenic
No off target data available for this crispr