ID: 1183702387

View in Genome Browser
Species Human (GRCh38)
Location 22:39457687-39457709
Sequence GGGCGCGGGCGCACTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 484}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183702368_1183702387 18 Left 1183702368 22:39457646-39457668 CCGGCTCCGCGGCCCACTCCCCG 0: 1
1: 0
2: 1
3: 33
4: 399
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702363_1183702387 25 Left 1183702363 22:39457639-39457661 CCCCCGCCCGGCTCCGCGGCCCA 0: 1
1: 0
2: 7
3: 61
4: 476
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702364_1183702387 24 Left 1183702364 22:39457640-39457662 CCCCGCCCGGCTCCGCGGCCCAC 0: 1
1: 0
2: 5
3: 59
4: 541
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702370_1183702387 6 Left 1183702370 22:39457658-39457680 CCCACTCCCCGAGCGTGACCTTA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702369_1183702387 12 Left 1183702369 22:39457652-39457674 CCGCGGCCCACTCCCCGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702362_1183702387 26 Left 1183702362 22:39457638-39457660 CCCCCCGCCCGGCTCCGCGGCCC 0: 1
1: 0
2: 14
3: 112
4: 905
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702366_1183702387 22 Left 1183702366 22:39457642-39457664 CCGCCCGGCTCCGCGGCCCACTC 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702377_1183702387 -1 Left 1183702377 22:39457665-39457687 CCCGAGCGTGACCTTAGGGGGCG 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702376_1183702387 0 Left 1183702376 22:39457664-39457686 CCCCGAGCGTGACCTTAGGGGGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702365_1183702387 23 Left 1183702365 22:39457641-39457663 CCCGCCCGGCTCCGCGGCCCACT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702367_1183702387 19 Left 1183702367 22:39457645-39457667 CCCGGCTCCGCGGCCCACTCCCC 0: 1
1: 0
2: 1
3: 54
4: 512
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702371_1183702387 5 Left 1183702371 22:39457659-39457681 CCACTCCCCGAGCGTGACCTTAG 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702378_1183702387 -2 Left 1183702378 22:39457666-39457688 CCGAGCGTGACCTTAGGGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183702387 Original CRISPR GGGCGCGGGCGCACTGGGGC TGG Intronic
900003581 1:29391-29413 AGGCGCGGGCGGACTGGGGGCGG - Intergenic
900023301 1:199907-199929 AGGCGCGGGCGGACTGTGGGCGG - Intergenic
900117186 1:1033783-1033805 GGGGCCGGGAGCGCTGGGGCTGG - Intronic
900165481 1:1242785-1242807 GGGCTCGGGTGCACTCGGGCTGG - Intronic
900349760 1:2228718-2228740 GGGCCCGGGCGCGCGGGAGCGGG + Exonic
900363564 1:2301402-2301424 GTGCTCGGGCGCACAGGGCCGGG - Intronic
900386324 1:2412624-2412646 GGGCGGGGCCGGACTGGGGCTGG + Intronic
900522329 1:3111641-3111663 GGGCGCACGCCCCCTGGGGCGGG + Intronic
901063765 1:6485503-6485525 GGGCGCGGCCGCACAATGGCAGG - Intronic
902216511 1:14937606-14937628 GGGAGCAGGCACACTGGGGTGGG - Intronic
902251268 1:15155252-15155274 GGGCTCTGGGTCACTGGGGCAGG - Intronic
902336896 1:15759071-15759093 GGGCGAGGGCTCAGTGAGGCCGG + Intronic
902931433 1:19734430-19734452 GGACCCGGGGGCACTGGTGCTGG - Intronic
903413848 1:23168336-23168358 GGGCGCGGGCCGACAGGGGCGGG - Intronic
903596991 1:24502745-24502767 GGGCGGGGGCGCGCGGGGGCCGG - Intronic
903674472 1:25055446-25055468 GGGCGGGTGGGCGCTGGGGCAGG - Intergenic
904062987 1:27725928-27725950 GGACCCGGGCGGGCTGGGGCGGG - Intergenic
904746958 1:32717297-32717319 GGGAGAGGGGGCACAGGGGCTGG - Intergenic
904753199 1:32753953-32753975 GGGCGTGGTCGAGCTGGGGCTGG + Intronic
905183188 1:36178850-36178872 GGGCGCGGGCGCCGCGGGCCGGG + Intronic
905432095 1:37931779-37931801 TGGAGCGGGCACACGGGGGCGGG - Intronic
905717068 1:40161323-40161345 GTGCGCGGGCGGCCGGGGGCAGG + Intergenic
905863892 1:41366514-41366536 GGGGGCGGCCGCCGTGGGGCCGG - Intronic
906952584 1:50346929-50346951 GGGGTTGGGCGCACTGGGGAAGG - Intergenic
907296757 1:53460511-53460533 GTGCGCAGGCGCACTGGGCCAGG - Intronic
910200145 1:84690553-84690575 CGGCGCCGGCGCGCGGGGGCGGG - Intronic
911449415 1:98045484-98045506 GGGGGCGGGGGCCCGGGGGCTGG - Intergenic
911854002 1:102854109-102854131 GGGACCGGGCGCCCTGGAGCAGG - Intergenic
912955879 1:114153814-114153836 CGCCCCGGCCGCACTGGGGCGGG + Intronic
913209460 1:116570870-116570892 CGGCGCGGGGCCCCTGGGGCAGG + Intronic
914337680 1:146730464-146730486 GCGCTGGGGTGCACTGGGGCCGG - Intergenic
914474941 1:148014741-148014763 GGGCGCGGTGGCTGTGGGGCGGG - Intergenic
914702812 1:150149933-150149955 GGGAGCGGCCGCGCTGGGCCGGG + Intronic
915142497 1:153776136-153776158 CGGCGCGCGCGCGCTGGTGCTGG + Exonic
915344197 1:155190474-155190496 GGGCGGTGGAGCCCTGGGGCCGG + Intronic
915722168 1:157993553-157993575 GGGCGCGGGCGGGCGGGGGGCGG + Intronic
916535310 1:165698335-165698357 AGGCTGGGGCGCCCTGGGGCCGG - Intronic
916577022 1:166076509-166076531 GGGATGGGGAGCACTGGGGCAGG - Intronic
917962300 1:180154772-180154794 GGGGGCGGGGGCTCGGGGGCGGG + Intergenic
917962307 1:180154786-180154808 GGGGGCGGGGGCTCAGGGGCGGG + Intergenic
920100953 1:203516773-203516795 GGGCACTGGGGCACTGGGGCAGG - Intergenic
920924487 1:210328894-210328916 GGGCGCGCGGGCACGGCGGCAGG + Exonic
921029698 1:211326758-211326780 GGGCGCGGGCGGAGGGGCGCGGG - Intronic
922116377 1:222618046-222618068 CGGGGCGGGCGCAGAGGGGCGGG - Intergenic
922958555 1:229625809-229625831 GCGCGCGGGCGGGCGGGGGCCGG - Intronic
924198953 1:241640182-241640204 GGCCGCGGGCGCTGAGGGGCCGG - Exonic
1064086241 10:12348830-12348852 CCGCGCGGGCGCCCTGGTGCTGG - Intergenic
1064086534 10:12349770-12349792 GGCCGGGGGCGCGCTGGGGAGGG - Exonic
1064409560 10:15093170-15093192 GGGCGGGGGCTGAGTGGGGCAGG + Intergenic
1064418233 10:15168722-15168744 GGGCGCGGGCGGGGCGGGGCGGG - Intergenic
1065204392 10:23343853-23343875 GGGCGCGAGGGCTCCGGGGCGGG + Intronic
1066602799 10:37125824-37125846 GGGCTCGGGCGCTCCGGGCCCGG - Intronic
1067037877 10:42932952-42932974 GGGCGCGGGAGCACAGGGCTGGG - Intergenic
1067684810 10:48459768-48459790 GAGCGCGGGCTCACTGAGGAGGG - Exonic
1070198030 10:74176834-74176856 GGACGCGGGCGCCGTGGCGCTGG + Intronic
1070327817 10:75399706-75399728 GGAGGTGGGCGCGCTGGGGCCGG + Exonic
1070596721 10:77837925-77837947 GGGCTCTGGCCCTCTGGGGCTGG - Intronic
1070937936 10:80315734-80315756 GGGACTGGGCGCCCTGGGGCAGG - Intergenic
1071491793 10:86141196-86141218 GGGGCCTGGAGCACTGGGGCAGG - Intronic
1072610504 10:97014421-97014443 GGGAGCGGGCACAGAGGGGCAGG + Intronic
1073306045 10:102504181-102504203 GGCCGGGGGCGCGGTGGGGCCGG - Exonic
1073376806 10:103042256-103042278 GGGCCCGGGAGCAATGGTGCAGG - Intronic
1073478762 10:103772365-103772387 GGGCGCGGGGGCGGTGAGGCAGG + Intronic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1076338840 10:129728799-129728821 GGAGGCGGGGGCATTGGGGCTGG - Intronic
1076404670 10:130203874-130203896 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076404676 10:130203884-130203906 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1076554295 10:131311824-131311846 GGGCGCGGGCGGGCGGGGACCGG - Intergenic
1076733096 10:132447891-132447913 GGCCGCGGGCGCCCGGAGGCAGG - Exonic
1076909111 10:133378770-133378792 GTGCGAGGGCGCAGTGGGTCTGG - Intergenic
1077063308 11:627010-627032 GGGTCAGGGCGCACTGGGGGCGG + Intronic
1077142795 11:1031773-1031795 GGGCCCGGGGGCTCGGGGGCCGG - Intronic
1077443901 11:2581388-2581410 GGGCCCAGGTGCACTGGGGTGGG - Intronic
1077494648 11:2880989-2881011 GGGCTGGGGTGCTCTGGGGCCGG - Intergenic
1077495741 11:2885815-2885837 GGGCCCGCGCGCACGGGGGTGGG - Exonic
1077610846 11:3642346-3642368 GGGAGCGGGCGCGCCAGGGCAGG + Intergenic
1078246212 11:9574521-9574543 GGGCGCGGGCACCCGGCGGCCGG + Intronic
1078758717 11:14234652-14234674 GGGCGGAGGGGCAGTGGGGCAGG + Intronic
1080418425 11:32090837-32090859 GGGCCCGGGCGAACTGGGCTAGG - Intronic
1080588339 11:33700511-33700533 GGGGGCGGGGGCGCCGGGGCGGG + Exonic
1081994588 11:47355217-47355239 GGCTGCGGGCTCAGTGGGGCGGG + Exonic
1082810471 11:57476451-57476473 GCGCGCGGCCGCTCTGGGCCTGG + Exonic
1083541035 11:63511660-63511682 GGCCAGGGGAGCACTGGGGCAGG - Intronic
1083678421 11:64340527-64340549 GTGCTTGGGCTCACTGGGGCAGG + Intronic
1083726297 11:64630319-64630341 GAGTGCGGCCGCACCGGGGCGGG - Intronic
1083747636 11:64744645-64744667 CGGCGCGGGCGGGCTGGGGGCGG - Intronic
1083766714 11:64844817-64844839 GGGCGGAGGCGCGCGGGGGCGGG + Intergenic
1084146153 11:67266429-67266451 GGGCGCGGGCGCGCGGGCGGCGG + Exonic
1084171222 11:67401872-67401894 GGCCGGGGGCGGACTGGGGCGGG - Intronic
1084499215 11:69525033-69525055 GGGCTGGGGGGAACTGGGGCTGG + Intergenic
1085396813 11:76210552-76210574 GGGCCCGTGCGCACTCCGGCTGG + Intronic
1085666218 11:78417615-78417637 GGGCGCGGCCGCCCAGGGGCGGG - Intronic
1087785312 11:102347395-102347417 GGGCTCGGGCGGCGTGGGGCGGG + Exonic
1088610368 11:111570803-111570825 GGGTGCGGGGGGACGGGGGCGGG - Intergenic
1089103883 11:115986193-115986215 GGGAGCTGGCACACAGGGGCAGG + Intergenic
1089650254 11:119908308-119908330 GGGAGCAGGAGCACAGGGGCTGG + Intergenic
1090224723 11:125063203-125063225 GAGGGCGGGCGCAAGGGGGCGGG + Intronic
1090224841 11:125063607-125063629 GAGCGCGGGCGGAGTTGGGCAGG - Intronic
1090267151 11:125360287-125360309 AGGAGTGGGGGCACTGGGGCCGG + Intronic
1090780255 11:130001837-130001859 GGGTGCAGGCGGACTGGGGCAGG + Intronic
1091174565 11:133546801-133546823 GGAGGAGGCCGCACTGGGGCAGG - Intergenic
1091304351 11:134528062-134528084 AGGAGCGGGGGCACTGGGGTGGG - Intergenic
1091377000 12:31445-31467 AGGCGCGGGCGGACTGTGGGCGG - Intergenic
1091616202 12:2052926-2052948 GGGCGCGGGCGCGGCGGGGCTGG + Intronic
1092262337 12:6959445-6959467 GGGTGCGGGGGCACAGGGTCAGG - Intronic
1092843344 12:12562962-12562984 GGGGGCGGGCGCGCGGGCGCGGG - Intergenic
1095812241 12:46383488-46383510 GGTCGCGGGCGCGCAGAGGCGGG - Intergenic
1095949255 12:47773125-47773147 GGGCGCGGGCGGCCTCCGGCCGG + Intronic
1096456958 12:51795482-51795504 GGCCGCTGGAGCTCTGGGGCTGG - Intronic
1096647635 12:53047332-53047354 GGGCGGGGGCGCGGCGGGGCGGG - Intronic
1096741253 12:53695655-53695677 AGGCGAGGGCGCGCTGGGGCGGG + Intergenic
1096804958 12:54135001-54135023 GGGCACTGGCGCACTTGTGCAGG - Intergenic
1096814919 12:54195998-54196020 GCGGGCGGGGGCAGTGGGGCCGG - Intergenic
1100355079 12:93821240-93821262 GGGCTGGGGAGAACTGGGGCAGG - Intronic
1100565323 12:95789845-95789867 GGGCGCGCGTGGGCTGGGGCCGG - Intronic
1100600689 12:96109195-96109217 GGGCCTGGGCGCCCTGGAGCAGG - Intergenic
1101902381 12:108800251-108800273 GGGCTCAGGGGCAGTGGGGCTGG + Intronic
1102185009 12:110941080-110941102 GGGCGGGAGAGCATTGGGGCGGG + Intergenic
1102375715 12:112419290-112419312 GGGTGGGGGCGCGGTGGGGCCGG - Intronic
1103348365 12:120265789-120265811 GGGCGCGCGTGCACAGGGGGCGG - Intergenic
1103595369 12:122021874-122021896 CGGCGCTTGCGCACTGGGCCAGG + Exonic
1103931627 12:124453768-124453790 GGGAGCGGGCGCAGTGGTGGAGG - Intronic
1104602426 12:130162571-130162593 CGGCGCGGGCACACCGAGGCCGG - Exonic
1106243475 13:27927918-27927940 GGGCGCGGGATGACTCGGGCAGG + Intergenic
1107779037 13:43879296-43879318 GGGAGCGGGCGCAGGGCGGCAGG - Exonic
1111841359 13:93454813-93454835 GGGAGTGGGCGCCCTGGAGCAGG + Intronic
1112290828 13:98143130-98143152 CGGCGCGGGCGCAGCGGTGCGGG + Intronic
1112309756 13:98308001-98308023 GGGGGCGGGCGGAGGGGGGCAGG - Intronic
1113895044 13:113759085-113759107 GGGAGCGGGCGCAGCGGGGGAGG + Intergenic
1113924014 13:113930360-113930382 GGGCGCAGGAGCACCGAGGCGGG + Intergenic
1113924021 13:113930382-113930404 GGGCGCAGGAGCACCGAGGCGGG + Intergenic
1113924028 13:113930404-113930426 GGGCGCAGGAGCACCGAGGCGGG + Intergenic
1115854170 14:37611513-37611535 AGGGGCTGGGGCACTGGGGCTGG + Intronic
1116817835 14:49599721-49599743 GGGCGCGGGCGCCGAGTGGCGGG + Intronic
1116919842 14:50560764-50560786 GGGCGCGGGCTCCCGGCGGCGGG + Intronic
1117131980 14:52695766-52695788 GGGCGCGGGCGCAGCGGACCGGG - Intronic
1118220941 14:63853689-63853711 GGGTCGGGGCGCACCGGGGCTGG + Intronic
1118773885 14:68961554-68961576 GGGCGCGGGGGCACGGGGGTGGG + Intronic
1119522821 14:75298743-75298765 GGGCGTGGACCCACTGGGGCTGG + Intergenic
1121616993 14:95319929-95319951 GGGCGCGGGCGGGGCGGGGCGGG + Intergenic
1121671594 14:95714364-95714386 AGGCGCGGGCCAGCTGGGGCCGG - Intergenic
1122216474 14:100208193-100208215 GGGACCGGGCGCCCTGGAGCAGG + Intergenic
1122491108 14:102116764-102116786 GGGCGCTGCCACAATGGGGCTGG + Intronic
1123037942 14:105478905-105478927 GGGCACGCGCGGGCTGGGGCTGG + Intronic
1123716737 15:23039304-23039326 GGGTCGGGGCGCGCTGGGGCAGG - Intronic
1124187223 15:27541608-27541630 GGAGGCGCACGCACTGGGGCAGG - Exonic
1124249830 15:28099403-28099425 GGGCGTGGCCGCACTGTGGGCGG - Intergenic
1125448338 15:39782470-39782492 GGGGGCGGGCTCATTGGGGGCGG - Intronic
1126102813 15:45129910-45129932 GGGGCGGGGCGCAGTGGGGCGGG - Intronic
1127753472 15:62068111-62068133 GGGCGAGCGCGTCCTGGGGCGGG - Exonic
1129232193 15:74203015-74203037 GGGCTTGGGAGCTCTGGGGCAGG - Intronic
1130335295 15:82952715-82952737 AGGCGCGGGCGGGCGGGGGCTGG + Exonic
1132147062 15:99435320-99435342 GGGTGGGGGCCCACAGGGGCCGG + Intergenic
1132449920 15:101961549-101961571 AGGCGCGGGCGGACTGTGGGCGG + Intergenic
1132514574 16:360176-360198 GGGCGGGGGCGCAGGTGGGCCGG - Intergenic
1132550750 16:553033-553055 GGGCGGGGGCGCACCTGTGCAGG - Exonic
1132558616 16:583552-583574 GGGCCCGGGCCCGCTGGGGACGG - Exonic
1132560227 16:590128-590150 GGGCGCGGGCGGGGCGGGGCCGG + Intronic
1132568928 16:635684-635706 GGGGCTGGGAGCACTGGGGCGGG - Exonic
1132642668 16:984909-984931 GGGCGGGGCCGCCCAGGGGCAGG - Exonic
1132719651 16:1309485-1309507 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1132779431 16:1614491-1614513 GGGCTCGGGCGGGCTCGGGCGGG + Intronic
1132868574 16:2105462-2105484 GGGCCCGCTCGTACTGGGGCAGG + Exonic
1132893081 16:2214117-2214139 GGGTCCGTGCGCCCTGGGGCGGG - Exonic
1133212936 16:4273152-4273174 GGGCGCGGGCCCCCGGGGACCGG + Intergenic
1134134149 16:11668581-11668603 GGGCGCCGGGGCCCGGGGGCGGG + Intronic
1134523015 16:14927197-14927219 GGGCCCGCTCGTACTGGGGCAGG - Intronic
1134549614 16:15132861-15132883 GGGCCCGCTCGTACTGGGGCAGG + Intronic
1134710682 16:16325848-16325870 GGGCCCGCTCGTACTGGGGCAGG - Intergenic
1134718853 16:16370136-16370158 GGGCCCGCTCGTACTGGGGCAGG - Intergenic
1134948919 16:18342797-18342819 GGGCCCGCTCGTACTGGGGCAGG + Intergenic
1134955903 16:18382023-18382045 GGGCCCGCTCGTACTGGGGCAGG + Intergenic
1136508435 16:30721266-30721288 GGGCTCAGGCGAACTGGGGCAGG - Exonic
1136611966 16:31371806-31371828 GGTGGCGGCCGCGCTGGGGCTGG + Intronic
1136636855 16:31529593-31529615 GGGCGGGGGCGCGCGGGGGGAGG + Intergenic
1136707673 16:32202529-32202551 GGGCGGGGGCGGAGCGGGGCGGG + Intergenic
1136760237 16:32726881-32726903 GGGCGGGGGCGGAGCGGGGCGGG - Intergenic
1136807867 16:33143505-33143527 GGGCGGGGGCGGAGCGGGGCGGG + Intergenic
1137686666 16:50391399-50391421 GGGCGAGGGTGCGCGGGGGCGGG + Intergenic
1138265275 16:55655992-55656014 GGGCGCGGGCTGACTGGTTCTGG - Intronic
1138472028 16:57245422-57245444 GGGCGCAGGCGACTTGGGGCCGG + Intronic
1138575853 16:57906895-57906917 GGGCAGGAGAGCACTGGGGCGGG + Intronic
1139402986 16:66696776-66696798 GGGAGCGGGCGCGCCGGGCCGGG + Intergenic
1139996601 16:70986864-70986886 GCGCTGGGGTGCACTGGGGCCGG + Intronic
1141864423 16:86740469-86740491 TGGCACGGGAGCTCTGGGGCCGG + Intergenic
1142049867 16:87951350-87951372 GGGCGCGCGGGCCCGGGGGCGGG - Intronic
1142210063 16:88804549-88804571 GGCCTCGGGGGTACTGGGGCTGG - Exonic
1142299415 16:89247732-89247754 GGCCGCGGGCGCGCGGGGTCCGG + Intergenic
1142350072 16:89575751-89575773 GGGCGCGGGCGCACGTGGCTCGG - Exonic
1142429746 16:90019569-90019591 GGGCGCGCGCGGGCCGGGGCGGG - Intronic
1142430265 16:90022670-90022692 GGGGGCGGGCGCCCTGGTCCCGG + Exonic
1203062391 16_KI270728v1_random:987203-987225 GGGCGGGGGCGGAGCGGGGCGGG - Intergenic
1142637721 17:1268408-1268430 GGGCGGGGGCGGGCGGGGGCGGG - Intergenic
1142712783 17:1732506-1732528 GGGCCAGGGCGGGCTGGGGCGGG + Intronic
1142805640 17:2369817-2369839 GGGTGCAGGTGCAGTGGGGCAGG - Intronic
1142984825 17:3689436-3689458 GGGCCTGGGGGCACTGGGCCTGG - Intronic
1143125894 17:4640722-4640744 GGACGCGGGCGGTCGGGGGCGGG + Intronic
1143135560 17:4710622-4710644 GCGCGCGTGCGCATTGGCGCGGG + Intronic
1143402586 17:6656100-6656122 GGACGCGGGCGATCGGGGGCGGG - Intergenic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1143732360 17:8888352-8888374 GGGAGCGGGAGCGCTGGGCCCGG + Exonic
1143747270 17:9003590-9003612 GGGCGCGGGCGCGGCAGGGCCGG - Intergenic
1144587741 17:16498157-16498179 GGACGTGGGGGCACTGGGGGAGG - Intergenic
1144804624 17:17956523-17956545 GGGACCGGGCGCAGTGGAGCAGG + Intronic
1144847047 17:18225560-18225582 GGGCGCGGGCGCGCGGGGCCGGG - Intergenic
1145089844 17:19977637-19977659 GGGTGCGGGGGGACTGGCGCGGG + Exonic
1145249654 17:21290133-21290155 GGGGGCTGCCTCACTGGGGCAGG + Intronic
1145937980 17:28726275-28726297 GGGCGCGGGCGGCTGGGGGCGGG - Intronic
1146053309 17:29568665-29568687 CGGCGCGGGGGCGCTGGGGCTGG + Exonic
1146371048 17:32265888-32265910 AGGCGAGGGCGCCCTTGGGCCGG - Intergenic
1146576111 17:33993127-33993149 GGGCACTGGAGCACTGAGGCTGG - Intronic
1146903035 17:36600625-36600647 GGGAGAGGGTGCAGTGGGGCAGG - Exonic
1147139642 17:38453917-38453939 GGCCTGGGGCGTACTGGGGCCGG + Intronic
1147204222 17:38825125-38825147 GGGCGGGGGAGGACTGAGGCCGG - Intronic
1147705377 17:42422049-42422071 GGGCGCGGGGGCGCAGGGTCTGG + Intronic
1148772749 17:50076527-50076549 GGGCGAGAGGGCACTGGGGGGGG + Intronic
1148945655 17:51260061-51260083 CGGCGCAGGCGCGCTGGGGAGGG - Exonic
1150207868 17:63422446-63422468 GGGCGCTGGCGGTCTGGGGAGGG - Exonic
1150284878 17:63949018-63949040 GGGTGGGGCAGCACTGGGGCTGG - Intronic
1150675739 17:67245024-67245046 GGGCGCGGCGGCCCCGGGGCAGG - Intronic
1151296916 17:73192847-73192869 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296922 17:73192861-73192883 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296928 17:73192875-73192897 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296934 17:73192889-73192911 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296940 17:73192903-73192925 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296946 17:73192917-73192939 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151296952 17:73192931-73192953 GGGGGCGGGCGCGAGGGGGCGGG - Intronic
1151511922 17:74566018-74566040 GGGCGGGGGGGCAGGGGGGCGGG + Intergenic
1152155900 17:78632527-78632549 GGGCGCGGTGGCTCAGGGGCTGG - Intergenic
1152718495 17:81911224-81911246 GGCCGCGGGGGCGCCGGGGCCGG - Intronic
1152747473 17:82048065-82048087 GGGCCCAGGCACAGTGGGGCAGG + Exonic
1153457430 18:5295894-5295916 GGGCGCGGGGGCACGGTGGGTGG + Exonic
1155611659 18:27673916-27673938 GGGACCGGGCGCCCTGGAGCAGG + Intergenic
1159040610 18:63320123-63320145 GGGCGCGGGAGGAAGGGGGCGGG + Exonic
1160163330 18:76491555-76491577 GGGGGCGGGCGCCGGGGGGCGGG + Intronic
1160164297 18:76496150-76496172 GAGGGCGGGCGCGCGGGGGCGGG + Intronic
1160204514 18:76822317-76822339 GGGCGCGGGCGCGGTGGGGGCGG - Intergenic
1160499585 18:79395493-79395515 GGGCAGGGGGGCGCTGGGGCTGG - Intergenic
1160571146 18:79818406-79818428 GGGAGGGGCCGCCCTGGGGCTGG - Intergenic
1160635334 19:70998-71020 AGGCGCGGGCGGACTGGGGGCGG - Intergenic
1160668523 19:344722-344744 GGGCGCGGACGCGCGGGGGCGGG + Intronic
1160725693 19:616924-616946 GGACGCGCGCGGACGGGGGCCGG - Exonic
1160726714 19:620801-620823 GAACGCGGGGGCCCTGGGGCAGG + Intronic
1160726789 19:620967-620989 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160726800 19:620988-621010 GGGCGCGGGGGCGCCGGGGGAGG + Intronic
1160824896 19:1074891-1074913 GGGCGGGGGCGGGCGGGGGCGGG + Intronic
1160858670 19:1228522-1228544 GGGCGCGGGAGGGCCGGGGCCGG + Exonic
1161203711 19:3029390-3029412 GGGGGCGGGTGCCCGGGGGCCGG - Intronic
1161307141 19:3574331-3574353 GGGGCCTGGCGTACTGGGGCAGG - Intronic
1161395860 19:4044537-4044559 AGGCGGGGGCGCCCGGGGGCCGG - Exonic
1161495658 19:4584497-4584519 GGGCGCGCAGGCATTGGGGCGGG - Intergenic
1161560393 19:4969509-4969531 GGCCGGGGGCGCGCGGGGGCTGG + Intronic
1161793273 19:6373272-6373294 GGGCGGGGCCACGCTGGGGCGGG + Intronic
1161793290 19:6373319-6373341 GGGCGGGGGCACTCTGGGGGCGG + Intronic
1162396925 19:10422690-10422712 GGGTGCAGGGGGACTGGGGCTGG - Intronic
1162517195 19:11155578-11155600 GGTCGCGGGCCCACGGGGGAAGG - Intronic
1162758351 19:12873884-12873906 GGGCGCGGGCGCACGACGGGAGG - Exonic
1163663930 19:18594422-18594444 GGGCCCGGGCGCTCTGGTGGTGG + Exonic
1163725154 19:18919186-18919208 GGGCGCGGGGACGCTGGGGGCGG - Intronic
1164648133 19:29873738-29873760 GGGCGCGGGGGCGCTGGGTGGGG - Intergenic
1165058531 19:33194141-33194163 GGGCGCGGGCGGGGCGGGGCTGG + Intronic
1165157860 19:33798568-33798590 GGGCCAGGGCGCACTGGGGCTGG + Exonic
1165199808 19:34134530-34134552 GGGCGCAGGCGCAGTGAGGTGGG - Intergenic
1165595699 19:37009907-37009929 GGCTGCGGGCGCCCTAGGGCCGG - Intronic
1165879360 19:39031777-39031799 GGGCGGGGCCGCACTGGGACCGG - Intronic
1165940679 19:39413430-39413452 GGGCCCAGGCGGACTGGGGGAGG + Intronic
1166064327 19:40348323-40348345 GGGCGCGGGCCCGGTGGGCCAGG - Intronic
1166386911 19:42387484-42387506 GGGCGCAGGCGCTCAGGGGCGGG + Intronic
1166986184 19:46661076-46661098 GGGCCCGGCCGGGCTGGGGCGGG - Exonic
1167072771 19:47230534-47230556 GGGCGCGCGCCCGCTGGGGGCGG - Intronic
1167323559 19:48810983-48811005 GGCCGCAGCCGCTCTGGGGCAGG - Exonic
1167369588 19:49072634-49072656 AGGCGGGGCCGCACCGGGGCCGG - Exonic
1168336523 19:55600350-55600372 GCGCGCGGGGGCAACGGGGCCGG - Intronic
925969471 2:9096527-9096549 GTGCGGGGGCCCCCTGGGGCAGG - Intergenic
925984836 2:9207069-9207091 GGGCGCTGGCGCACAGCCGCAGG - Exonic
927945748 2:27134260-27134282 GAGCGCAGGGCCACTGGGGCTGG - Intronic
928158054 2:28894640-28894662 GTGCGCAGGCGCACCGGCGCGGG - Exonic
929033674 2:37671711-37671733 GCGCGGGGACTCACTGGGGCGGG + Exonic
929452947 2:42048514-42048536 GGGCGCCGTCGGACAGGGGCCGG - Exonic
929597278 2:43184207-43184229 GGGCGCCGGGGAACTGGGGTGGG - Intergenic
929936187 2:46296390-46296412 GGGCAGGGGAGCACTGGGCCCGG + Intronic
929966820 2:46542777-46542799 GGGCGCGGGCGCCGAGTGGCGGG + Exonic
932320788 2:70820684-70820706 GGGGAGGGGCCCACTGGGGCGGG - Intergenic
933886129 2:86720465-86720487 GGGCTAGGGCGCCATGGGGCAGG + Exonic
933924052 2:87076241-87076263 GGGCTAGGGCGCCATGGGGCAGG - Intergenic
934085171 2:88503429-88503451 GGGACCGGGCGCCCTGGAGCAGG - Intergenic
935746573 2:106194341-106194363 GGGCGGGGGCGCGCGGCGGCAGG - Intergenic
936452841 2:112646178-112646200 GGGCGCGGACGCCGTGGCGCTGG + Intronic
937096053 2:119235895-119235917 GGGCACTGGGGCACTGGGGTCGG - Intronic
937991436 2:127664416-127664438 GGGCGCGGGCCGCCTGGTGCAGG + Exonic
938301139 2:130213741-130213763 GGGCGCGGGCGCCCAGTGGCGGG - Intergenic
938455576 2:131460726-131460748 GGGCGCGGGCGCCGAGTGGCGGG + Intergenic
939580133 2:143937443-143937465 GGGCTCGGGCGAGCCGGGGCCGG + Intergenic
940971876 2:159904448-159904470 GGGCGGGGGGGCTCTGGAGCCGG - Intronic
942045861 2:172099126-172099148 GGGCGCGGGGGCGGTGGCGCCGG + Intergenic
942454743 2:176130070-176130092 GGGCGGCGGCGCGCGGGGGCTGG + Exonic
943516233 2:188890846-188890868 GGGCGGGAGCCCACTGAGGCAGG - Intergenic
943798266 2:192026066-192026088 GGGGAGGGGCGCACAGGGGCAGG - Intronic
946959748 2:224971407-224971429 GGGCGCGGTTGCACTGTAGCAGG + Intronic
947156019 2:227164067-227164089 GGGCGCGGGTGGATTGGGGCTGG - Exonic
947514001 2:230785369-230785391 GGGCGCGTGGGCAGGGGGGCAGG + Intronic
948402310 2:237692659-237692681 GGGAGCGGGCGCAGTGGGCGCGG + Intronic
948449791 2:238061710-238061732 GGAAGCTGGTGCACTGGGGCAGG + Intronic
948553389 2:238791037-238791059 GGACCCAGGCGCAGTGGGGCTGG + Intergenic
948609640 2:239158711-239158733 GGGCGGGTGCGCGGTGGGGCGGG - Intronic
948945672 2:241217919-241217941 GGGCGGGGGCGCGCAGGGGCGGG + Intronic
948945774 2:241218126-241218148 GAGCGGGGGCGCGCAGGGGCGGG + Intronic
949079865 2:242088461-242088483 GGGCGCGGGGGGGCGGGGGCGGG - Intergenic
1168805988 20:672701-672723 GGGCGGGGGAGGCCTGGGGCTGG - Intronic
1168965093 20:1894256-1894278 GGGCGCGGGGGCGCGGGGGGCGG - Exonic
1169118622 20:3082820-3082842 GAGCACGGGCGCCCTGGGGCGGG + Intronic
1169120448 20:3092814-3092836 GGGCGCGGAAGCTCGGGGGCCGG + Intergenic
1169227756 20:3866691-3866713 GGGAGGGGGCCCAGTGGGGCAGG - Exonic
1170969098 20:21101904-21101926 GGGCGCGACCGCCTTGGGGCAGG + Intergenic
1171010706 20:21507940-21507962 GCGCGCGGGCGCTTCGGGGCCGG + Intergenic
1171012132 20:21514591-21514613 GGGGGTGGGCGCGCGGGGGCGGG - Intergenic
1171452909 20:25248433-25248455 GGGCACGGGCGCACAGGGCGGGG - Intronic
1171484310 20:25476491-25476513 CGGCGCGAGCGCAGCGGGGCTGG - Exonic
1172529312 20:35619120-35619142 GGGCGCGGGGGCGCGGGGGCTGG - Intronic
1172793452 20:37521592-37521614 AGGCGCGGGCGCACTAGGGAGGG - Intronic
1172834950 20:37867395-37867417 GAGGGAGGGGGCACTGGGGCTGG - Intronic
1173279697 20:41617902-41617924 GGGCCCAGCCGCGCTGGGGCGGG - Intronic
1173605195 20:44326758-44326780 AGGCGCGGGGGCGCGGGGGCGGG + Intergenic
1173734299 20:45348470-45348492 GGGCGGGGGCGGGCCGGGGCGGG - Intergenic
1173874993 20:46364506-46364528 GGGCGGGGCAGCACGGGGGCGGG + Intergenic
1175210462 20:57350893-57350915 GGGGGCGGGGGGACGGGGGCGGG + Intergenic
1175286725 20:57841591-57841613 GGGCACAGGCACACTGGGGTGGG - Intergenic
1175739226 20:61408896-61408918 GGTCACGGGCCCACTGGGACTGG + Intronic
1175859625 20:62143382-62143404 GGGCGCGGGCGTAGTGGCGCCGG - Exonic
1176131731 20:63499201-63499223 GGGCGCGGACGCGCGCGGGCGGG + Exonic
1176373414 21:6075873-6075895 GGGCGCGGGCCCATGGGGGACGG + Intergenic
1176414702 21:6467752-6467774 TGGGGCGGGCGGACTGGGGTGGG - Intergenic
1176427026 21:6554413-6554435 GGGTGCAGGTGCACTGGGGGAGG - Intergenic
1176510554 21:7744870-7744892 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1178644667 21:34375399-34375421 GTGCGCAGGCGCAGTGGGCCCGG - Intergenic
1179411827 21:41168260-41168282 GGGCATGGGCGCACTGGCCCGGG + Exonic
1179574943 21:42302112-42302134 GGCCTCAGGCACACTGGGGCAGG - Intergenic
1179690202 21:43076074-43076096 TGGGGCGGGCGGACTGGGGTGGG - Intronic
1179702517 21:43162735-43162757 GGGTGCAGGTGCACTGGGGGAGG - Intergenic
1179750063 21:43462370-43462392 GGGCGCGGGCCCATGGGGGACGG - Intergenic
1179783868 21:43719058-43719080 GGCCGGGGGCGGACCGGGGCGGG - Intergenic
1180014637 21:45074383-45074405 GGGCGCGGGGCCGTTGGGGCTGG - Intronic
1181094324 22:20495534-20495556 GGGCGCGGGCGCGTAGGGGCCGG - Intronic
1181162046 22:20965147-20965169 GGCCGCGGGCGCGGGGGGGCGGG - Exonic
1181573175 22:23778883-23778905 GGGTGGGGGCACACTGGGACTGG - Intronic
1182554193 22:31120228-31120250 GGGGGTGGGCGTACTGAGGCAGG - Intergenic
1182604007 22:31489604-31489626 GGGCGCGGGCGCATTGCTCCCGG - Intronic
1183192254 22:36329146-36329168 GGGTGGGGGCGCAGAGGGGCTGG + Intronic
1183402046 22:37610233-37610255 GGGCCCTGACACACTGGGGCTGG + Intronic
1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG + Intronic
1184101605 22:42344034-42344056 GGGCGCGGGTGGGCGGGGGCTGG - Intergenic
1184523111 22:45007441-45007463 GGGCGGGGGCGCGCGGGGGCGGG + Intronic
1184557450 22:45240948-45240970 GGGCGGGGCCGGACCGGGGCCGG - Intergenic
1184656171 22:45943340-45943362 GGCCTCGGGCGCACGGGCGCCGG - Intronic
1184681052 22:46072196-46072218 GGGCGTGGGCGTCCCGGGGCCGG + Intronic
1185177141 22:49334396-49334418 GGGGGCGGGGGCACAGGGTCTGG - Intergenic
1185338274 22:50280425-50280447 GGCCGCAGGGGCTCTGGGGCTGG - Intronic
1185340785 22:50290116-50290138 GGGCGTGGCCACAGTGGGGCTGG - Exonic
1185389207 22:50549735-50549757 GGGCGGGGGCGGGCAGGGGCAGG - Exonic
1185394048 22:50577954-50577976 GTGCGCGGGCGCGCTTAGGCCGG + Intronic
950087662 3:10272009-10272031 GGGGGCGGGCGCAGTGGCTCAGG - Intronic
950168143 3:10816688-10816710 GTGCGCGTGCGCACTGGCACAGG - Intronic
950438493 3:12994155-12994177 GGGCGCGGGGGGGCGGGGGCGGG + Intronic
950438496 3:12994169-12994191 GGGGGCGGGCGCTCGGGAGCCGG + Intronic
951139718 3:19146953-19146975 GGGCGGGGGCGCGCCGGGGAGGG - Intergenic
952430583 3:33219140-33219162 GGGCGAGGGCGCAGGGAGGCGGG + Exonic
952706191 3:36380402-36380424 GGCCGCGGGCGCGGCGGGGCGGG + Exonic
952730699 3:36634241-36634263 GGGACCGGGCGCCCTGGAGCAGG - Intergenic
953061552 3:39432335-39432357 GGGCTTGAGGGCACTGGGGCTGG + Intergenic
953748696 3:45594036-45594058 GCGGGCGGGCGCCCAGGGGCAGG - Intronic
953982869 3:47421367-47421389 GGGCGGGGGCTCAGTGGGGAAGG - Intronic
954437490 3:50503733-50503755 CGGCGGGGGCGCGCGGGGGCGGG - Intronic
954632824 3:52056370-52056392 GAGCGCGGGCGGCCCGGGGCCGG + Exonic
956432181 3:69198130-69198152 GGGGGCGGGCGGAGGGGGGCGGG + Intronic
959131687 3:102363755-102363777 GGGGTCTGGCTCACTGGGGCTGG - Intronic
960149110 3:114232678-114232700 GGGCCCAGGGGGACTGGGGCTGG - Intergenic
960223766 3:115146984-115147006 GGGCGCGGGCGGGGCGGGGCGGG + Intronic
961585024 3:127915315-127915337 GTGCGCAGGCGCACAGTGGCTGG + Exonic
961681738 3:128604151-128604173 GGGCGGGGGGGCACTGGGAAAGG + Intergenic
961754907 3:129121815-129121837 GGGCGGGGGCGGGCTGGGGCGGG - Intronic
963904708 3:150763531-150763553 GGACGCGGGCGGGCAGGGGCGGG + Intergenic
966878306 3:184336001-184336023 GGTCGCGGCCACACTGGGGAGGG - Intronic
967858200 3:194134118-194134140 GGGGGTGGGGGCACGGGGGCCGG + Intergenic
968063951 3:195747964-195747986 GGGCGGGGCCGGGCTGGGGCGGG - Intronic
968479114 4:826053-826075 GGGCGCGGGCGGTCAGCGGCGGG + Exonic
968616293 4:1579189-1579211 GGGCGGGGGCGCGCCAGGGCAGG - Intergenic
968647908 4:1749238-1749260 GGGAGGGGGCGCAGTGGGGAGGG - Intergenic
968975870 4:3821789-3821811 GGGTGTGGGCTCCCTGGGGCAGG + Intergenic
969330752 4:6472382-6472404 GGGCGGGGGCGGCCGGGGGCGGG + Intronic
969645816 4:8428262-8428284 GGGCGCGGACGCGACGGGGCGGG - Intronic
970399406 4:15703230-15703252 GGGCGCGCGCGCGGTGGCGCGGG + Exonic
970593236 4:17577391-17577413 GGGCGGGCGCGCCTTGGGGCGGG - Exonic
971635162 4:29047861-29047883 GGGACCGGGCGCCCTGGAGCAGG - Intergenic
972034732 4:34506603-34506625 GAGTGCGGGTGCACTGGCGCGGG - Intergenic
972663223 4:41137920-41137942 GAGCCTGGGCGCACTGAGGCAGG + Intronic
972776648 4:42247501-42247523 AGGCTCAGGGGCACTGGGGCGGG - Intergenic
972782961 4:42301808-42301830 GGGGGCGGGTGCTGTGGGGCAGG - Intergenic
976053067 4:81031158-81031180 GGGCGAGGGCGCACGGAGCCCGG - Exonic
976743381 4:88379229-88379251 GGGCGCGGGGGCCCAGGTGCAGG + Intronic
977574090 4:98658739-98658761 GCGCGCGCGCGCACGGGGTCGGG + Intergenic
978532598 4:109730058-109730080 CGGCGCAGGCGCACAGGGGACGG - Exonic
978749532 4:112231710-112231732 GGGCCTGGGCGCGCTGGGGGCGG + Intergenic
982257658 4:153466298-153466320 GGGCGGGGCGGCACGGGGGCGGG + Intergenic
982840234 4:160175076-160175098 GGGTGTGGGTGGACTGGGGCAGG - Intergenic
983940227 4:173529397-173529419 GGGCCCGGGCGCCCGGGGGCTGG - Exonic
984639171 4:182144246-182144268 GGGCTCGGGCACACTCGGCCCGG + Intronic
984801807 4:183722996-183723018 CGAGGCGGGCGCCCTGGGGCTGG + Intergenic
984966364 4:185143509-185143531 GGGCGCGGGCGCGGCGGGCCGGG + Intronic
985089291 4:186346978-186347000 GGACGCGGGCACCCTGGAGCTGG + Intergenic
985780987 5:1871718-1871740 GCACGCGGGCGCCCTGGGGCAGG - Intergenic
990545178 5:56815403-56815425 ACGGGCGGGCGCACTGGGTCCGG - Intergenic
993901162 5:93584945-93584967 GCGCGCGGGCGCGCTGGGAGGGG - Exonic
997584058 5:135034349-135034371 CGGCGCGGGCGGCTTGGGGCTGG - Intronic
1002111904 5:176921518-176921540 GAGAGCGGGAACACTGGGGCAGG - Intronic
1002251097 5:177929921-177929943 GGGCGTGAGCGGACTGTGGCTGG + Intergenic
1002531992 5:179852723-179852745 GGGAGAGGTGGCACTGGGGCTGG + Intronic
1002580881 5:180208963-180208985 GGGCGCGGGCTCGCGGGGGCTGG - Intronic
1002592895 5:180303442-180303464 GGGCGCGGGCGCAATGAGAGTGG + Intronic
1003290735 6:4776482-4776504 GGGGCCGGGCGGGCTGGGGCGGG - Exonic
1003645593 6:7910840-7910862 GGGCGCGGCCTCTCCGGGGCGGG - Intronic
1004140573 6:13013864-13013886 GGCCCCGGGCGCCCGGGGGCCGG + Intronic
1004262067 6:14117537-14117559 CGGCCCGGGCGCGCGGGGGCGGG + Intronic
1004499516 6:16197432-16197454 TGGGGGGGGCGCAGTGGGGCGGG + Intergenic
1004651579 6:17614621-17614643 GGGGGCGGGAGAACTGGGGGGGG + Intergenic
1005964878 6:30720285-30720307 GGGCGCGCGTGCGCCGGGGCTGG - Exonic
1006466201 6:34196345-34196367 GGGCGCGGGTGGACTGGGCTTGG - Intergenic
1007166394 6:39831781-39831803 GGGGGCAGGTGCACTGGGGGGGG + Intronic
1007431754 6:41780719-41780741 GGGCGGGGGCGGACGGGGGCGGG + Intronic
1007557919 6:42782478-42782500 GGGCGGGGGCGCAGGCGGGCAGG + Intronic
1007665276 6:43509884-43509906 GGTCGCGGGCGGAGTGGGGCCGG + Exonic
1008013531 6:46491954-46491976 GGGCGCTGGCGCCCTCTGGCTGG + Intronic
1010585224 6:77650516-77650538 GGGCACGGGAGCCCTGGAGCAGG - Intergenic
1011470434 6:87702300-87702322 GAGCGCTTGCGCACGGGGGCGGG + Intergenic
1012276730 6:97283187-97283209 GAGCGCGGGCGCGCGGTGGCGGG - Intronic
1013369104 6:109455053-109455075 GCGCCCGGGCGCACAGGGGGCGG - Intronic
1014098245 6:117482799-117482821 CGGCGGCGGCGCACTGGCGCGGG + Exonic
1014913223 6:127118268-127118290 AGACTTGGGCGCACTGGGGCTGG - Intergenic
1015251795 6:131135400-131135422 AGGCGCGGACGCGCTCGGGCAGG - Intergenic
1018669695 6:166168169-166168191 GGGCTGGGGCGGGCTGGGGCAGG - Intronic
1018669699 6:166168179-166168201 GGGCTGGGGCGGGCTGGGGCGGG - Intronic
1019528591 7:1492819-1492841 GGGCGCGGGCTTACCCGGGCGGG + Intronic
1019528608 7:1492860-1492882 GGGCGCGGGCTTACCCGGGCGGG + Intronic
1019528649 7:1492962-1492984 GGGCGCGGGCTTACCCGGGCGGG + Intronic
1019562534 7:1665780-1665802 GGGCGCGGGCGCAGTGGTGGCGG - Intergenic
1019689619 7:2403469-2403491 GGGCGCAGGCGCGCTGAGGGCGG + Intergenic
1020274325 7:6615593-6615615 GGGGGCGGGGGCGCGGGGGCCGG - Intergenic
1020278231 7:6637287-6637309 GGGCGCGGGCGGGGCGGGGCCGG + Intergenic
1022008840 7:26291817-26291839 GGGTGGGGGCGCACCTGGGCTGG + Intergenic
1023965845 7:44962727-44962749 GGGTGCGGGCGCTCAGCGGCTGG + Exonic
1024784435 7:52890774-52890796 GGGCAGGGGCACAGTGGGGCAGG + Intergenic
1025173980 7:56787578-56787600 GCGGTCGGGCGCGCTGGGGCTGG - Intergenic
1025198615 7:56949171-56949193 GGGCGCGGGCGCGCAGGGTCAGG - Intergenic
1025651740 7:63476182-63476204 GGGCGGGGGGGCACAGGGCCTGG + Intergenic
1025673337 7:63627765-63627787 GGGCGCGGGCGCGCAGGGTCAGG + Intergenic
1025698120 7:63790377-63790399 GCGGTCGGGCGCGCTGGGGCTGG + Intergenic
1026522744 7:71131497-71131519 GTGCGCGCGCGCACCCGGGCAGG - Intergenic
1026764832 7:73154104-73154126 GGGCGCGTGGGCCCTGGGGTTGG + Intergenic
1026850323 7:73719573-73719595 GGGCGGCCGCGCGCTGGGGCCGG + Intronic
1026850375 7:73719747-73719769 GGGCCCGGGCGGGGTGGGGCGGG - Intergenic
1026909403 7:74083735-74083757 GGGCGCGGGCGGCCGGCGGCGGG - Intronic
1027082335 7:75238502-75238524 GGGCGCGTGGGCCCTGGGGTTGG - Intergenic
1028929059 7:96392670-96392692 GGGCGGGGGCGGAATGGGGAGGG - Intergenic
1029436853 7:100568489-100568511 GGGCGGGGGGGCCGTGGGGCGGG - Intergenic
1029537002 7:101162959-101162981 CGGCGGGGGCGCGCGGGGGCGGG + Exonic
1030018088 7:105244610-105244632 CGGCCCTGGCGCGCTGGGGCTGG - Intronic
1030033457 7:105388965-105388987 GGGCGGGGCCGGACGGGGGCGGG - Intronic
1030980639 7:116182008-116182030 GGGACCGGGCGCCCTGGAGCAGG + Intergenic
1031025197 7:116672252-116672274 CGGCCCGGGCGCGTTGGGGCCGG - Intergenic
1031096565 7:117427509-117427531 GGGCGCATGCGCACCGGGGTGGG + Exonic
1032193814 7:129778925-129778947 GGGGGCAGGGGCACTGAGGCCGG - Intergenic
1033365997 7:140673036-140673058 GGTCGCGGGCGCCCGGGGCCTGG + Intronic
1033589385 7:142797190-142797212 GGGCGCGGGCGGCTTGGGTCTGG + Intergenic
1034475079 7:151277004-151277026 GGGCGCCGGCGCAGCGCGGCCGG + Intronic
1034649219 7:152676177-152676199 GCGCGCGTGCGCACTGCGCCAGG + Intergenic
1034951087 7:155297644-155297666 CGGCCCGCGCGCACTCGGGCGGG - Intergenic
1035224061 7:157424063-157424085 GGGCGAGGGCGCCAAGGGGCTGG + Intergenic
1035553076 8:544851-544873 GGACGCGGGCCCAGTGGGCCGGG + Intronic
1036378249 8:8218957-8218979 GGGCATGGGCTCACTGGGCCCGG + Intergenic
1036578821 8:10054386-10054408 GGGCGCGGGCGGGCGGGCGCGGG - Exonic
1036786713 8:11692746-11692768 GGGCGCGGACGGACGGGGGGCGG + Intronic
1037305248 8:17497319-17497341 GGGCGAGGGCGCCCTGGGGCCGG + Intronic
1037811471 8:22089395-22089417 GGGCGCGGGCCCCCTCGGGCAGG + Intronic
1038727641 8:30095545-30095567 GGACGCGGGAGGGCTGGGGCCGG + Intronic
1039964095 8:42271425-42271447 GGGGGCGGGCTCCCCGGGGCGGG - Exonic
1040462163 8:47659599-47659621 GGGCGGGGACGCATTGGGGGCGG - Intronic
1043640227 8:82441756-82441778 GAGTGCGGGCGCACCGGCGCTGG + Intergenic
1045663970 8:104466631-104466653 GGGCGGGGGCGCGGCGGGGCGGG + Intronic
1046547304 8:115668467-115668489 GGGCGCGGGCGCCCCTCGGCCGG - Intronic
1049389481 8:142360610-142360632 GGGGGCGGGGGCCCTGGGGAGGG - Intronic
1049440211 8:142606154-142606176 GGGAGCAGGGCCACTGGGGCAGG + Intergenic
1049457286 8:142700240-142700262 GGGCGCGGGAGCCCTGGGAAAGG - Exonic
1049570867 8:143369727-143369749 GGGCGTGGGCGCCCAGGGCCTGG - Intronic
1049639891 8:143710744-143710766 ATGCGCGGGTGCAGTGGGGCTGG - Intronic
1049719263 8:144108123-144108145 GGGCGCGGGCGCGCGGGGTCAGG - Exonic
1049771903 8:144386745-144386767 GGGAGCGGGAGGACCGGGGCTGG - Intronic
1049798044 8:144505506-144505528 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798061 8:144505548-144505570 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798079 8:144505590-144505612 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798097 8:144505632-144505654 GGGCGCGGGGGGAGTGGGGCGGG - Intronic
1049798115 8:144505674-144505696 GGGCGCGGAGGGAGTGGGGCGGG - Intronic
1049798131 8:144505716-144505738 GGGTGCGGGAGGAGTGGGGCGGG - Intronic
1049830649 8:144699291-144699313 TGGGGCGGGCGCTGTGGGGCGGG + Intergenic
1051079598 9:13279304-13279326 GTGCGCGGGCGCCCTGGGCTCGG - Intronic
1053046674 9:34926203-34926225 GGGATCTGGCTCACTGGGGCTGG + Intergenic
1056386303 9:86099672-86099694 GGGCGCGCGCACCGTGGGGCCGG - Intronic
1056643180 9:88388303-88388325 CTGCGCAGGCGCAGTGGGGCGGG - Intergenic
1059208262 9:112486801-112486823 GGGCGCGGGCGGGCCGGGGCGGG - Intronic
1060106774 9:120877428-120877450 GGGCGGGGGCGGGCGGGGGCTGG - Intronic
1060477950 9:123999687-123999709 GGGCGCGTGCGGCCGGGGGCGGG - Intergenic
1060713024 9:125889738-125889760 GGGCGGGGGCGCGCCGCGGCGGG + Intronic
1060897152 9:127225270-127225292 GGGCTCGGGCGCACTCGGGTGGG - Intronic
1060996552 9:127877535-127877557 GGGCGGGGGCGTGCTGGTGCGGG - Intronic
1061134273 9:128724193-128724215 GGGCGGGGCCGGACTGGGTCAGG + Intergenic
1061575346 9:131502887-131502909 GCGCGCGTGCGCACTGGGAGAGG - Intronic
1061580012 9:131530901-131530923 GGGCCGGGGCGGGCTGGGGCGGG - Intronic
1061797947 9:133099150-133099172 GGGCGCCAGAGCCCTGGGGCAGG - Intronic
1061947399 9:133916418-133916440 GGGCCCGGGCGCACAGGCCCAGG + Intronic
1062022576 9:134326389-134326411 GGGCGCGGGCGCGCGGCGGCGGG + Intronic
1062122926 9:134843568-134843590 GGGAGTGGACGCACCGGGGCGGG - Exonic
1062332789 9:136051834-136051856 CGGAGCGGGAGCCCTGGGGCGGG + Intronic
1062370175 9:136234757-136234779 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1062370197 9:136234834-136234856 TGGGGCGGGCGCAGTGGAGCTGG - Intronic
1062436659 9:136549370-136549392 GGGCGTGGGGGCTCTGAGGCGGG + Intergenic
1062474850 9:136721855-136721877 GGGCAGGGGCTCAGTGGGGCAGG + Intronic
1062532810 9:137009237-137009259 GGGGCTGGGGGCACTGGGGCTGG - Intronic
1062547432 9:137070022-137070044 GGGCGCGCACGCCCAGGGGCAGG + Exonic
1062629919 9:137458961-137458983 GGGCAGGGGCGGACTCGGGCGGG + Intronic
1185464164 X:345493-345515 GTGCGTGGGGGCACAGGGGCGGG - Intronic
1189325249 X:40107710-40107732 CGGCTCGGGCGCAGCGGGGCTGG - Intronic
1190316722 X:49156422-49156444 GGGCGCTGGGGCACGCGGGCGGG + Intergenic
1194890440 X:99372098-99372120 GGGACCGGGCGCAGTGGAGCAGG + Intergenic
1198268533 X:135032746-135032768 GGGGGCGGGTGCTCTGGGGAGGG + Exonic
1198517557 X:137425028-137425050 GGGGGCGGGGGCCCGGGGGCGGG + Intergenic
1200098144 X:153673724-153673746 GGGCGGGGGCGCACCGGATCCGG - Intronic
1200146132 X:153927256-153927278 GGGCGTGGGGGCACTAGTGCAGG + Intronic
1201153487 Y:11107858-11107880 GGGGGCGGCTGCACCGGGGCAGG + Intergenic
1201159344 Y:11156115-11156137 GGGAGCGGGGTCACGGGGGCAGG - Intergenic