ID: 1183702387

View in Genome Browser
Species Human (GRCh38)
Location 22:39457687-39457709
Sequence GGGCGCGGGCGCACTGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 537
Summary {0: 1, 1: 0, 2: 2, 3: 50, 4: 484}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183702371_1183702387 5 Left 1183702371 22:39457659-39457681 CCACTCCCCGAGCGTGACCTTAG 0: 1
1: 0
2: 0
3: 5
4: 46
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702378_1183702387 -2 Left 1183702378 22:39457666-39457688 CCGAGCGTGACCTTAGGGGGCGG 0: 1
1: 0
2: 0
3: 1
4: 27
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702364_1183702387 24 Left 1183702364 22:39457640-39457662 CCCCGCCCGGCTCCGCGGCCCAC 0: 1
1: 0
2: 5
3: 59
4: 541
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702366_1183702387 22 Left 1183702366 22:39457642-39457664 CCGCCCGGCTCCGCGGCCCACTC 0: 1
1: 0
2: 2
3: 31
4: 289
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702376_1183702387 0 Left 1183702376 22:39457664-39457686 CCCCGAGCGTGACCTTAGGGGGC 0: 1
1: 0
2: 0
3: 3
4: 40
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702363_1183702387 25 Left 1183702363 22:39457639-39457661 CCCCCGCCCGGCTCCGCGGCCCA 0: 1
1: 0
2: 7
3: 61
4: 476
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702377_1183702387 -1 Left 1183702377 22:39457665-39457687 CCCGAGCGTGACCTTAGGGGGCG 0: 1
1: 0
2: 1
3: 1
4: 34
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702370_1183702387 6 Left 1183702370 22:39457658-39457680 CCCACTCCCCGAGCGTGACCTTA 0: 1
1: 0
2: 0
3: 2
4: 48
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702368_1183702387 18 Left 1183702368 22:39457646-39457668 CCGGCTCCGCGGCCCACTCCCCG 0: 1
1: 0
2: 1
3: 33
4: 399
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702367_1183702387 19 Left 1183702367 22:39457645-39457667 CCCGGCTCCGCGGCCCACTCCCC 0: 1
1: 0
2: 1
3: 54
4: 512
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702362_1183702387 26 Left 1183702362 22:39457638-39457660 CCCCCCGCCCGGCTCCGCGGCCC 0: 1
1: 0
2: 14
3: 112
4: 905
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702369_1183702387 12 Left 1183702369 22:39457652-39457674 CCGCGGCCCACTCCCCGAGCGTG 0: 1
1: 0
2: 0
3: 11
4: 127
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484
1183702365_1183702387 23 Left 1183702365 22:39457641-39457663 CCCGCCCGGCTCCGCGGCCCACT 0: 1
1: 0
2: 3
3: 26
4: 305
Right 1183702387 22:39457687-39457709 GGGCGCGGGCGCACTGGGGCTGG 0: 1
1: 0
2: 2
3: 50
4: 484

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183702387 Original CRISPR GGGCGCGGGCGCACTGGGGC TGG Intronic