ID: 1183702974

View in Genome Browser
Species Human (GRCh38)
Location 22:39460192-39460214
Sequence CCATCTCCAAGCCCTTCATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 427
Summary {0: 1, 1: 0, 2: 2, 3: 40, 4: 384}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183702964_1183702974 21 Left 1183702964 22:39460148-39460170 CCCCTTTGCTCCCCAGAGTGCAG 0: 1
1: 0
2: 1
3: 48
4: 492
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702966_1183702974 19 Left 1183702966 22:39460150-39460172 CCTTTGCTCCCCAGAGTGCAGTG 0: 1
1: 0
2: 3
3: 34
4: 878
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702965_1183702974 20 Left 1183702965 22:39460149-39460171 CCCTTTGCTCCCCAGAGTGCAGT 0: 1
1: 0
2: 0
3: 19
4: 239
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702963_1183702974 27 Left 1183702963 22:39460142-39460164 CCAGAGCCCCTTTGCTCCCCAGA 0: 1
1: 0
2: 5
3: 48
4: 374
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702968_1183702974 10 Left 1183702968 22:39460159-39460181 CCCAGAGTGCAGTGATGCAGCCC No data
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702967_1183702974 11 Left 1183702967 22:39460158-39460180 CCCCAGAGTGCAGTGATGCAGCC 0: 1
1: 0
2: 2
3: 24
4: 212
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702970_1183702974 -10 Left 1183702970 22:39460179-39460201 CCCCTCATCTTAGCCATCTCCAA 0: 1
1: 0
2: 0
3: 37
4: 241
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384
1183702969_1183702974 9 Left 1183702969 22:39460160-39460182 CCAGAGTGCAGTGATGCAGCCCC 0: 1
1: 0
2: 4
3: 78
4: 589
Right 1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG 0: 1
1: 0
2: 2
3: 40
4: 384

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183702974 Original CRISPR CCATCTCCAAGCCCTTCATG TGG Intronic
902658585 1:17886270-17886292 CCATCTCCAGGCCCCTCCAGGGG - Intergenic
904289266 1:29473666-29473688 CCATCTGCAGGCCCTTCCTGGGG + Intergenic
904425386 1:30419445-30419467 CAATCTCCAACCCATTCATGTGG + Intergenic
904586086 1:31581423-31581445 CCATCTCCAAGCCCTGCTGATGG + Intronic
905042424 1:34971050-34971072 TCAGCACCAAGCCTTTCATGAGG - Intergenic
908070208 1:60452206-60452228 CCATCAACAAGCCCTTCAGAAGG - Intergenic
908690325 1:66772420-66772442 ACAGCACCAAGCCATTCATGAGG + Intronic
910123730 1:83818131-83818153 ACAGCACCAAGCCATTCATGAGG - Intergenic
912124039 1:106510844-106510866 GCAGCTCCAAGCCGTCCATGAGG + Intergenic
912664977 1:111570825-111570847 GCAGCACCAAGCCATTCATGAGG + Intronic
913217882 1:116635773-116635795 GCATTTCAAAGCCCTTCATCTGG + Intronic
913355853 1:117921472-117921494 ACATCTCCCAGAGCTTCATGTGG - Intronic
916561000 1:165934057-165934079 ACTTCTCCAAGCCCTGCCTGGGG - Intergenic
916975353 1:170071697-170071719 ACAGCACCAAGCCATTCATGAGG + Intronic
917476279 1:175372012-175372034 ACAGCTCCAAGCCATTCATGAGG - Intronic
918666535 1:187157708-187157730 ACAGCACCAAGCCATTCATGAGG - Intergenic
918835030 1:189450998-189451020 CCATCTTCAAGCCAATCATGGGG + Intergenic
918910229 1:190558567-190558589 ACAGCACCAAGCCATTCATGAGG - Intergenic
921261144 1:213386073-213386095 ACAGCACCAAGCCATTCATGAGG - Intergenic
922543652 1:226437636-226437658 TCATTTACAAGCCCTACATGTGG - Intergenic
922927671 1:229363799-229363821 ACAGCACCAAGCCATTCATGAGG - Intergenic
923150194 1:231226178-231226200 ACAGCACCAAGCCATTCATGAGG - Intronic
923541280 1:234889972-234889994 CCATCTCCATTCCTTTCATGGGG - Intergenic
923557129 1:235010014-235010036 CTATCCCCAAGCCCTGCCTGTGG - Intergenic
1062917246 10:1250356-1250378 ACAGCACCAAGCCCTTCATAAGG - Intronic
1062968585 10:1628993-1629015 ATGTCTCCAAGCCCCTCATGAGG - Intronic
1063557167 10:7091933-7091955 ACATCACCAAGCCATTCATGAGG + Intergenic
1064851728 10:19715900-19715922 GCAGCACTAAGCCCTTCATGGGG + Intronic
1065078592 10:22105261-22105283 ACAGCACCAAGCCATTCATGAGG - Intergenic
1065852318 10:29801132-29801154 CCAACACCAAGACATTCATGAGG + Intergenic
1066099359 10:32103979-32104001 ACAGCACCAAGCCATTCATGAGG + Intergenic
1067254050 10:44617933-44617955 GCAGCACCAAGCCATTCATGAGG + Intergenic
1067468855 10:46522001-46522023 ACAGCACCAAGCCATTCATGAGG + Intergenic
1067810904 10:49426421-49426443 ACAGCACCAAGCCATTCATGAGG + Intergenic
1069661735 10:70127586-70127608 CCTGCTCCGGGCCCTTCATGGGG + Intronic
1069771045 10:70900622-70900644 ACATGTCCAAGTCCTGCATGAGG - Intergenic
1070867907 10:79719189-79719211 ACAGCACCAAGCCATTCATGAGG + Intergenic
1071257407 10:83883877-83883899 ACTTCACCAAGCCATTCATGAGG - Intergenic
1071400644 10:85266364-85266386 ACAGCACCAAGCCTTTCATGAGG + Intergenic
1071634818 10:87241390-87241412 ACAGCACCAAGCCATTCATGAGG + Intergenic
1071913485 10:90263151-90263173 ACAGCACCAAGCCATTCATGAGG - Intergenic
1072611984 10:97023598-97023620 CCATCTCTAAGTCTCTCATGTGG - Intronic
1072616666 10:97054166-97054188 GCAGCACCAAGCCATTCATGAGG - Intronic
1074035756 10:109736537-109736559 TCATCTCAAAACCCTTTATGAGG - Intergenic
1074389442 10:113044712-113044734 CCTTCTCCTATCCCTTCATTGGG - Intronic
1074533130 10:114310592-114310614 CCAGCCCCAAGGCCTGCATGTGG + Intronic
1074886848 10:117700660-117700682 CCATTTCAAGGCCCTGCATGCGG - Intergenic
1075562211 10:123476249-123476271 GCATCACGAAGCCGTTCATGAGG - Intergenic
1075620038 10:123919991-123920013 ACAGCACCAAGCCTTTCATGAGG + Intronic
1076174921 10:128360983-128361005 CTATCTCTAGGCCCTTCCTGGGG - Intergenic
1076721602 10:132395750-132395772 CCAACACTAAGCCCTTCCTGGGG - Intergenic
1077143205 11:1033878-1033900 ACCTCTCCAGGCCCTTCTTGGGG + Intronic
1078837810 11:15048607-15048629 CCAACTCCAAATCCATCATGAGG + Intronic
1080495274 11:32811769-32811791 ACAGCACCAAGCCATTCATGAGG + Intergenic
1080547264 11:33333034-33333056 ACAGCACCAAGCCATTCATGAGG + Intronic
1082284384 11:50302900-50302922 CCATGCCCAGCCCCTTCATGTGG + Intergenic
1084497949 11:69516180-69516202 ACAGCACCAAGCCATTCATGAGG + Intergenic
1085618033 11:78016703-78016725 CCATCTCCAGGCAGTGCATGAGG + Exonic
1086874898 11:92083782-92083804 ACAGCACCAAGCCATTCATGAGG - Intergenic
1088454081 11:110015298-110015320 ACAGCACCAAGCCATTCATGAGG + Intergenic
1089318127 11:117605913-117605935 CCATCTCCAACCCATCCAGGGGG - Intronic
1089754497 11:120676665-120676687 ACAGCACCAAGCCATTCATGAGG + Intronic
1090418201 11:126555530-126555552 CCATCCCCAAACCCTTCACCTGG - Intronic
1091146047 11:133281290-133281312 ACAGCACCAAGCCATTCATGAGG - Intronic
1091726269 12:2848644-2848666 CCTCCTCCAAACCCTGCATGGGG + Intronic
1092268082 12:6998848-6998870 CCTGCTCCAAACCCTTCATTAGG + Intronic
1093771230 12:23020964-23020986 GCAGCACCAAGCCATTCATGGGG + Intergenic
1093960713 12:25270012-25270034 ACAGCACCAAGCCGTTCATGAGG + Intergenic
1094169926 12:27480606-27480628 ACAGCACCAAGCCATTCATGAGG - Intronic
1094732256 12:33191557-33191579 ACAGCACCAAGCCATTCATGAGG - Intergenic
1095599880 12:44002311-44002333 CCATCTCCAAGGCCTCCATTAGG - Intronic
1095734701 12:45543943-45543965 CCAGCTTCAAGCTCTTCATGGGG - Intergenic
1095838707 12:46668836-46668858 ACAACACCAAGCCCTTCATGAGG + Intergenic
1096102931 12:48980346-48980368 CCGGTCCCAAGCCCTTCATGAGG + Intronic
1096548929 12:52359613-52359635 CCCTGTCCAACCCCTCCATGCGG - Intergenic
1096995515 12:55835717-55835739 CAACCTCCAGGCCCTTCATTAGG + Intronic
1097244488 12:57599657-57599679 CCATCCCCAAGCCTTCCATATGG - Intronic
1098996500 12:77126715-77126737 CTATCTTCAATCCCTTCTTGGGG - Intergenic
1099517675 12:83618297-83618319 ACAGCACCAAGCCATTCATGAGG + Intergenic
1100397309 12:94196295-94196317 ACAGCACCAAGCCATTCATGAGG - Intronic
1100783985 12:98059635-98059657 ACAGCACCAAGCCATTCATGAGG - Intergenic
1100839078 12:98593861-98593883 CCGTCTCCACGCCCTTGAAGAGG - Intronic
1103193675 12:119024153-119024175 CCAGCTCCTGGCCCATCATGGGG + Intronic
1103844928 12:123894683-123894705 GCCTCCCCAAGCCCTCCATGCGG + Exonic
1103981934 12:124742366-124742388 CCATCTGGACGCCCTTCCTGCGG - Intergenic
1105630386 13:22157736-22157758 ACAGCACCAAGCCATTCATGTGG + Intergenic
1106479098 13:30123625-30123647 CCATCGCCAGGCTCCTCATGGGG + Intergenic
1106502963 13:30346895-30346917 TCAGCACCAAGCCATTCATGAGG - Intergenic
1107739402 13:43433342-43433364 ACAACACCAAGCCATTCATGAGG + Intronic
1107872795 13:44762526-44762548 ACAGCACCAAGCCATTCATGAGG + Intergenic
1108196943 13:48004279-48004301 ACAGCACCAAGCCCTTCATGAGG - Intergenic
1108678142 13:52755875-52755897 ACAGCACCAAGCCATTCATGAGG + Intergenic
1108785319 13:53893299-53893321 CCAGCACTAAGCCATTCATGAGG - Intergenic
1109828987 13:67761211-67761233 ACAGCACCAAGCCATTCATGAGG + Intergenic
1109845956 13:67991162-67991184 GCAGCACCAAGCCATTCATGAGG + Intergenic
1109973123 13:69796362-69796384 ACAGCACCAAGCCATTCATGAGG - Intronic
1111482462 13:88848903-88848925 ACAGCACCAAGCCATTCATGAGG + Intergenic
1111931298 13:94515612-94515634 ACCACTCCAAGCCCTTCTTGAGG - Intergenic
1111990307 13:95109843-95109865 ATATCTCCAAGCCCAACATGGGG + Intronic
1112361754 13:98724999-98725021 ACAGCACCAAGCCATTCATGAGG - Intronic
1112860155 13:103820218-103820240 ACAACACCAAGCCATTCATGAGG + Intergenic
1113448199 13:110386857-110386879 CCTTCTAGCAGCCCTTCATGGGG - Intronic
1113818055 13:113189047-113189069 ACAGCACCAAGCCATTCATGAGG - Intronic
1114425906 14:22622391-22622413 ACAGCACCAAGCCATTCATGAGG + Intergenic
1114590982 14:23864471-23864493 CCATGTCTAAGTCCTTCCTGGGG - Intergenic
1114710946 14:24777591-24777613 GCATCTGCAAGCCCTGCATCTGG - Intergenic
1114744642 14:25134503-25134525 CCTTCTCCTACCCCTTCAAGGGG - Intergenic
1115645827 14:35367959-35367981 CCTCCTCCCAGCCCTGCATGGGG + Intergenic
1115765030 14:36614484-36614506 GCAGCACCAAGCCATTCATGAGG - Intergenic
1116660127 14:47699491-47699513 ACATCGCCAAGCCACTCATGAGG - Intergenic
1117182172 14:53202020-53202042 CCCTCTACAAGCCCTTTATTTGG - Intergenic
1117805881 14:59490291-59490313 ACAGCTCCAAGTCATTCATGAGG + Intronic
1118173362 14:63411580-63411602 ACAGCACCAAGCCATTCATGAGG - Intronic
1118572467 14:67207426-67207448 ACAGCACCAAGCCATTCATGAGG + Intronic
1119115345 14:72015315-72015337 GCAGCACCAAGCCATTCATGAGG + Intronic
1119561066 14:75590253-75590275 TCAGCACCAAGCCGTTCATGGGG + Intronic
1120231208 14:81843579-81843601 TCATGACCAAGCCATTCATGAGG + Intergenic
1121111163 14:91314045-91314067 CCTTCTCCACGTCTTTCATGCGG + Exonic
1121639779 14:95477542-95477564 CCATCCCCAGGCCCTGCACGGGG + Intergenic
1122087218 14:99316378-99316400 CCGTCTCAAAGGCCATCATGCGG - Intergenic
1122113135 14:99515285-99515307 CCAGCTCCAAGCCCTCCATACGG - Exonic
1122585733 14:102805195-102805217 CCATCACCACTCCCATCATGGGG + Intronic
1122831449 14:104399105-104399127 ACAGCCCCAAGCCATTCATGAGG - Intergenic
1122841314 14:104465106-104465128 CCAACACCAAGCCCTTGATATGG - Intergenic
1122888555 14:104722400-104722422 CCAGCTCTGAGCCCTTCCTGGGG - Intronic
1124025855 15:25964848-25964870 GCATCTCCAACCCCCTCAAGGGG + Intergenic
1124651752 15:31479158-31479180 CCACCTCTAGGCCCTTCATACGG + Exonic
1125411569 15:39411509-39411531 CCCTCTCCAAATCCTTCCTGAGG - Intergenic
1125833275 15:42730798-42730820 GCATCTCCCAGCCCTTCCTAGGG - Intronic
1127245340 15:57167096-57167118 CCATCTGCATGCTCTACATGAGG + Intronic
1127770806 15:62229151-62229173 ACAGCACCAAGCCATTCATGAGG + Intergenic
1128559571 15:68655779-68655801 CCATCCCCAAGCCCCTCAACAGG + Intronic
1128750601 15:70146357-70146379 ACAGCACCAAGCCATTCATGAGG + Intergenic
1128837051 15:70817570-70817592 ACATCTCCAAGCTATTCAGGGGG - Intergenic
1129129684 15:73482266-73482288 ACAGCACCAAGCCATTCATGAGG - Intronic
1133800489 16:9081199-9081221 ACAGCACCAAGCCATTCATGAGG - Intergenic
1135060731 16:19269355-19269377 TCATCACCAAGCCGTTCATGAGG + Intergenic
1135530273 16:23247026-23247048 ACAGCACCAAGCCATTCATGAGG - Intergenic
1135665044 16:24328696-24328718 CTTTCTCCCAGCCCTTCACGGGG - Intronic
1135811088 16:25587425-25587447 ACATCTCTGAGCCCTTCATGTGG + Intergenic
1135847708 16:25933875-25933897 CCAACACCAAGCAATTCATGAGG + Intronic
1135987473 16:27194604-27194626 ACAGCGCCAAGCCATTCATGAGG + Intergenic
1136984109 16:35083740-35083762 CCATCTTCAAGCCCTTCTGAGGG - Intergenic
1137700858 16:50496688-50496710 ACAGCACCAAGCCATTCATGAGG - Intergenic
1138023672 16:53505536-53505558 ACAGCACCAAGCCTTTCATGAGG - Intergenic
1138611031 16:58124181-58124203 CCAGCCCTAAGCCCTTAATGTGG - Intronic
1138744064 16:59342900-59342922 ACAGCACCAAGCCATTCATGAGG - Intergenic
1142162537 16:88565944-88565966 CCAGCTCCAAGCCCTGCCTCTGG - Intergenic
1142672082 17:1491933-1491955 GCATCTCCAGCCCCTTCCTGCGG + Intronic
1143099995 17:4499517-4499539 CTATCTCCAGGCCCTACGTGAGG + Intronic
1143267353 17:5649931-5649953 TCATCTCCAACCCAGTCATGAGG + Intergenic
1144112493 17:12049679-12049701 CCAAATCTAAGCCCTTTATGAGG - Intronic
1144410995 17:15001662-15001684 ACAGCACCAAGCCATTCATGAGG - Intergenic
1144702629 17:17348988-17349010 CATTCTCCTGGCCCTTCATGAGG - Intergenic
1145770288 17:27487909-27487931 ACAGCACCAAGCCATTCATGAGG + Intronic
1145915923 17:28574005-28574027 CCATCTTCAGGTCCTTCTTGTGG - Intronic
1146987990 17:37240521-37240543 CCATCACCACAGCCTTCATGTGG + Exonic
1147854865 17:43471981-43472003 CCATCTCAAAGCCTTGTATGAGG - Intergenic
1148063486 17:44852316-44852338 CCCTCTCCAAGCCCTAAGTGAGG - Intronic
1148124036 17:45227907-45227929 CCAGCTCCAGGTCCTCCATGTGG + Intronic
1149002442 17:51771185-51771207 TCTTCACCAAGCCATTCATGAGG + Intronic
1149025209 17:52018884-52018906 ACAGCACCAAGCCATTCATGAGG - Intronic
1149294595 17:55250377-55250399 ACAGTTCCAAGCCATTCATGAGG - Intergenic
1150305946 17:64085465-64085487 ACAGCGCCAAGCCATTCATGAGG + Intronic
1151167659 17:72219239-72219261 CCAGCTTCCAGCCCTTCATGGGG - Intergenic
1151547649 17:74802959-74802981 CCATCTCCATTCACTTCCTGGGG - Intronic
1151770816 17:76159464-76159486 CCATCTCCAAGCACGTGAAGTGG + Exonic
1151813363 17:76458490-76458512 CCATCTCCCAGCCTTTCGTGGGG + Intronic
1153137994 18:1940165-1940187 ACAGCACCAAGCCATTCATGAGG - Intergenic
1153167940 18:2283311-2283333 CCATTCCCAAGTCCTTAATGTGG + Intergenic
1153483851 18:5575350-5575372 GCAGCACCAAGCCATTCATGAGG - Intronic
1153588477 18:6648101-6648123 GCATTTGCAAGCCCTTCATTAGG - Intergenic
1156494802 18:37518657-37518679 CCATCCCCAAGCCCTACCTCAGG + Intronic
1157771899 18:50356268-50356290 ACAGCACCAAGCCATTCATGAGG - Intergenic
1158201885 18:54950327-54950349 TTATCTCCAAACCCTTGATGAGG + Intronic
1160092578 18:75840961-75840983 CCAACACTAAGCCCTTCATATGG + Intergenic
1162828625 19:13270093-13270115 CCATCTCCCAGCCCTGAATACGG - Intronic
1162892529 19:13744307-13744329 CTTTCTCCAAGCCCCTCAGGAGG + Intronic
1163446731 19:17351500-17351522 CCAACTCCCAGCCCTGCCTGTGG - Exonic
1163690733 19:18736914-18736936 CCACCTGCCAGCCCTTCCTGGGG - Intronic
1164588315 19:29491589-29491611 ACAGCACCAAGCCGTTCATGGGG + Intergenic
1164762073 19:30735708-30735730 CCACCTGCCAGCCCTTCCTGAGG - Intergenic
1165167289 19:33865818-33865840 CATTCACCAAGCCATTCATGAGG + Intergenic
1165935112 19:39384341-39384363 CCACCTCCAACCTCTTCATCCGG - Exonic
1166449651 19:42887406-42887428 GCAGCACCAAGCCATTCATGAGG - Intronic
1166460952 19:42987703-42987725 GCAGCACCAAGCCATTCATGAGG - Intronic
1166478240 19:43147691-43147713 GCAGCACCAAGCCATTCATGAGG - Intronic
1167652994 19:50743335-50743357 ACAGCACCAAGCCATTCATGAGG - Intergenic
1167714415 19:51132051-51132073 ACAGCACCAAGCCATTCATGAGG - Intronic
1168125436 19:54280050-54280072 CCATCCCCAAGCCCACCCTGTGG - Exonic
1168400347 19:56082032-56082054 CCATATCCAAGCCCTCACTGCGG + Intergenic
1168657333 19:58140141-58140163 ACAGCACCAAGCCATTCATGCGG - Intronic
925850377 2:8075863-8075885 CCATCTTCACTCCTTTCATGAGG + Intergenic
926729899 2:16028696-16028718 CCATCTCCAATCCCATCCCGGGG - Intergenic
927069149 2:19507647-19507669 GCATCTCCCAGGCCTTCATGGGG - Intergenic
927211972 2:20644645-20644667 CCTGCTCCAAGCCCTTGATTTGG + Intronic
929894330 2:45945440-45945462 ACAGCCCCAAGCCATTCATGAGG + Intronic
929901127 2:46004799-46004821 CATTCTCCAAGACCTTCTTGAGG + Intronic
931263112 2:60637563-60637585 ACAGCTCCAAGCCATTCGTGAGG + Intergenic
931383363 2:61774276-61774298 ACATCTCCAAGTCTTTCTTGTGG + Intergenic
932144088 2:69304031-69304053 TCACTTCCAAGCCCTTCATGTGG + Intergenic
932884601 2:75537692-75537714 GCAACACCAAGCCATTCATGAGG - Intronic
933184457 2:79263277-79263299 ACAGCACCAAGCCATTCATGAGG - Intronic
933655539 2:84883862-84883884 TCATCCTCAAGCCATTCATGAGG + Intronic
934089801 2:88541325-88541347 ACAGCACCAAGCCATTCATGAGG + Intergenic
934856936 2:97735394-97735416 CCATCTCCATGACCAGCATGAGG - Exonic
935146371 2:100398292-100398314 CTATCCCCAGCCCCTTCATGAGG + Intronic
935589673 2:104835106-104835128 ACATCTCCCAGCCCTTCATGAGG - Intergenic
936348661 2:111695578-111695600 CCATCACCCAGCCGTTTATGAGG - Intergenic
937410142 2:121667884-121667906 ACAGCACCAAGCCATTCATGAGG + Intergenic
938878886 2:135564050-135564072 ACAGCACCAAGCCATTCATGAGG + Intronic
939023917 2:136989322-136989344 ACAGCACCAAGCCATTCATGAGG - Intronic
939593631 2:144097931-144097953 GCATCTCTAAGTCCTCCATGCGG + Intronic
939607247 2:144268094-144268116 CCACCCCCAAGCCATTCATGAGG - Intronic
939966357 2:148614090-148614112 TCATTACCAAGCCATTCATGAGG - Intergenic
939985972 2:148830188-148830210 CCAGCACCAAGACATTCATGAGG - Intergenic
940896366 2:159085075-159085097 ACAGCACCAAGCCATTCATGAGG - Intronic
941696026 2:168551576-168551598 CCATCTCACAGGCGTTCATGAGG + Intronic
941834113 2:169997316-169997338 GCAGCTCCAAGCTCTTCCTGTGG + Intronic
941879359 2:170465422-170465444 ACAGCACCAAGCCATTCATGAGG + Intronic
942318018 2:174712171-174712193 ACAGCACCAAGCCATTCATGAGG + Intergenic
942592072 2:177556927-177556949 ACAGCACCAAGCCATTCATGAGG - Intergenic
942816247 2:180057500-180057522 TCATCTCCTAGCCCATTATGGGG - Intergenic
944506663 2:200419369-200419391 CCTTCTCGCAGCCATTCATGGGG - Exonic
944766161 2:202866213-202866235 TCATCACCAAGCCATTCAGGAGG - Intronic
945845934 2:214944461-214944483 CCATCTCCAAGCCCCTTCTTTGG - Intronic
946431276 2:219628323-219628345 CCAACTCCAAGCCCTAGTTGGGG - Intronic
947588349 2:231370622-231370644 CCATCTTCAGGCCCTTCTGGCGG - Intronic
947739006 2:232476414-232476436 CCACCTCCATGCCCCCCATGGGG - Intergenic
948248809 2:236508414-236508436 CCCTCCCAAAGCCCTTCAGGGGG + Intergenic
1169148864 20:3273634-3273656 ACAGCACCAAGCCATTCATGAGG + Intronic
1169412251 20:5381671-5381693 CCACCGCTAAGCCATTCATGAGG + Intergenic
1169412264 20:5381721-5381743 CCACCGCTAAGCCATTCATGAGG + Intergenic
1170590021 20:17764875-17764897 CTCTCACCAAGCCATTCATGAGG + Intergenic
1171215017 20:23345986-23346008 CCTTCTCCAAGTCCTTGCTGTGG - Intergenic
1172435153 20:34923772-34923794 ACAGCACCAAGCCATTCATGAGG + Intronic
1172781953 20:37441975-37441997 CTCTCTCCAAGCCCTTTATCAGG + Intergenic
1173183298 20:40820680-40820702 ACACCTCCAAGCCCTTCACTTGG + Intergenic
1173997464 20:47349623-47349645 CCATCTCCGAGGGCTGCATGGGG - Intronic
1174288868 20:49492748-49492770 CCATCTCCAAGGCTTTGATGAGG + Intergenic
1174457558 20:50660530-50660552 GCACTTCCAAGCCATTCATGAGG + Intronic
1175522808 20:59613017-59613039 TCAGCACCAAGCCATTCATGAGG + Intronic
1175751397 20:61500410-61500432 CCCTCTCCACGCCCGTGATGTGG - Intronic
1176289101 21:5034848-5034870 CCATCACCAGTCCCTTCCTGTGG - Intronic
1177054094 21:16277885-16277907 CCACCTCCAAGCTATTCTTGGGG + Intergenic
1178705777 21:34871683-34871705 GCATCTGCAAGCCCATCCTGTGG + Intronic
1178740535 21:35196083-35196105 ACAGCACCAAGCCATTCATGAGG - Intronic
1179066517 21:38029665-38029687 TCATCTCCAAGCACTTCACATGG - Intronic
1179348662 21:40585734-40585756 ACACCACCAAGCCATTCATGAGG - Intronic
1179717639 21:43298001-43298023 CCCCCTCCCAGGCCTTCATGAGG - Intergenic
1179868134 21:44228756-44228778 CCATCACCAGTCCCTTCCTGTGG + Intronic
1179887004 21:44318574-44318596 CCATCTGCACGCACTCCATGAGG - Exonic
1179978146 21:44882418-44882440 CCATCCCCAAGCCCCTCGGGAGG - Intergenic
1181409151 22:22705879-22705901 GCATCTCCAGCCCCTGCATGGGG - Intergenic
1181661571 22:24354133-24354155 ACAGCACCAAGCCATTCATGAGG + Intronic
1181943783 22:26499295-26499317 CCATCTCCAGGACCTTGCTGAGG + Exonic
1182357307 22:29728015-29728037 CCATCTCTGAGCCCTGCATGTGG - Intronic
1182418959 22:30239431-30239453 CCTTCTGCAATCCCTTCCTGGGG - Intergenic
1182543009 22:31055408-31055430 CCATCTCCAAGCCCCAAATTTGG + Intergenic
1182937411 22:34238401-34238423 ACAGCACCAAGCCATTCATGAGG + Intergenic
1183049634 22:35250498-35250520 ACAGCACCAAGCCATTCATGAGG + Intergenic
1183408761 22:37642889-37642911 TCATCTCCAAGGCCTTCCTGTGG - Exonic
1183695271 22:39418174-39418196 CCATCTCGCAGCTGTTCATGGGG - Intronic
1183702974 22:39460192-39460214 CCATCTCCAAGCCCTTCATGTGG + Intronic
1184764660 22:46565383-46565405 CAAGCACCAAGCCGTTCATGAGG + Intergenic
949151404 3:772376-772398 CCATCTCCTAGAACTTCAGGAGG - Intergenic
949548972 3:5096659-5096681 CCTTCTGCAAGCCCTGCATGAGG - Intergenic
949602893 3:5620232-5620254 ACAGCACCAAGCCATTCATGAGG - Intergenic
952875396 3:37940677-37940699 CCATCCCTAAGCCAGTCATGTGG + Intronic
953296945 3:41728463-41728485 ACAGCTCCAAGCCATTCATGAGG + Intronic
954004765 3:47581868-47581890 CGAGCACCAAGCCATTCATGGGG - Intergenic
954752892 3:52823621-52823643 CCATCTCTGAGCCCTTGAAGAGG + Exonic
955308858 3:57863689-57863711 ACAGCACCAAGCCATTCATGAGG + Intronic
956524961 3:70148739-70148761 GCAGCACCAAGCCATTCATGAGG + Intergenic
956586950 3:70875122-70875144 ACATCACCAAGCCATTCATGAGG - Intergenic
957511035 3:81187459-81187481 GCATCACCAAGCCTTTCATGAGG - Intergenic
957656805 3:83089894-83089916 ACAACACCAAGCCATTCATGAGG + Intergenic
958459329 3:94374630-94374652 ACAGCACCAAGCCATTCATGAGG + Intergenic
959933716 3:112009112-112009134 TCAGCACCAAGCCATTCATGAGG + Intronic
960903278 3:122573194-122573216 ACAGCACCAAGCCATTCATGGGG + Exonic
961562379 3:127739684-127739706 CCATCCCAAAGCCCTCCATAAGG - Intronic
962478439 3:135778119-135778141 CCATCTCCTACCCCTTCCTGTGG - Intergenic
962479379 3:135785561-135785583 CAAGCTCCATGCCCCTCATGAGG + Intergenic
962760105 3:138503749-138503771 CCATGGCAAAGCCCTTCTTGGGG + Intronic
962916650 3:139910521-139910543 CCTTCTCCAATGCCTTCATGTGG - Intergenic
965005483 3:163017579-163017601 CCCTCTCAAAGGCCTCCATGGGG - Intergenic
965545785 3:169915143-169915165 CCAACTCTTTGCCCTTCATGAGG + Intronic
967603745 3:191419379-191419401 ACCTCTCCAAGTCATTCATGAGG - Intergenic
968781705 4:2587342-2587364 ACAGCACCAAGCCATTCATGAGG + Intronic
970126562 4:12819419-12819441 ACACCACCAAGCCATTCATGAGG + Intergenic
970176653 4:13346248-13346270 ACAGCACCAAGCCATTCATGAGG - Intergenic
970374810 4:15446445-15446467 ACAGCACCAAGCCATTCATGAGG + Intergenic
970468643 4:16353036-16353058 CCATAGCCAAGCCTTTCATCTGG - Intergenic
970538257 4:17052160-17052182 ACTTCTCCAAGCCCTTCCTTTGG - Intergenic
970707396 4:18821639-18821661 ACAGCACCAAGCCATTCATGAGG - Intergenic
972681386 4:41309993-41310015 ACAGCACCAAGCCATTCATGAGG - Intergenic
975448944 4:74501726-74501748 CAATCTACAAACACTTCATGTGG - Intergenic
976282052 4:83335062-83335084 CCATCTCCGCACCCTTCAAGTGG - Exonic
981041593 4:140227867-140227889 ACGGCACCAAGCCCTTCATGAGG - Intergenic
981531326 4:145756381-145756403 GCATCTCCAAGCCAGTCATGAGG - Intronic
982210066 4:153027696-153027718 ACAGCACCAAGCCATTCATGAGG + Intergenic
982307175 4:153944790-153944812 ACAGCACCAAGCCATTCATGAGG + Intergenic
983037467 4:162885484-162885506 ACAACAACAAGCCCTTCATGAGG + Intergenic
983271424 4:165566982-165567004 ACATCTCCAAGCACTTCATTCGG - Intergenic
983621818 4:169769812-169769834 ACAACACCAAGCCATTCATGAGG - Intergenic
984278765 4:177641462-177641484 CATTCTCCCAGCTCTTCATGGGG - Intergenic
986237718 5:5927468-5927490 GCATCTCCAAGTGCTTCCTGCGG - Intergenic
986297163 5:6449081-6449103 CCTTCTCGCCGCCCTTCATGCGG + Exonic
986400726 5:7376928-7376950 CCATCTCAAACCCCATCTTGTGG - Intergenic
987007432 5:13724687-13724709 ACAGCACCAAGCCATTCATGAGG - Intronic
988288259 5:29250290-29250312 TCAGCACCAAGCCATTCATGAGG - Intergenic
989005009 5:36800508-36800530 ACAGCACCAAGCCATTCATGAGG - Intergenic
989111278 5:37908512-37908534 ACAGCACCAAGCCATTCATGGGG - Intergenic
990690675 5:58360300-58360322 ACTTCTTCCAGCCCTTCATGGGG + Intergenic
991972115 5:72151279-72151301 ACAGCACCAAGCCATTCATGAGG + Intronic
992023255 5:72646226-72646248 CCATCTCCAAGTACTCCATGAGG + Intergenic
993142987 5:84057336-84057358 CCATTTGCAATCCCTTTATGTGG + Intronic
995668063 5:114567150-114567172 ACAGCACCAAGCCATTCATGAGG + Intergenic
995820471 5:116224637-116224659 ACAGCACCAAGCCATTCATGAGG + Intronic
996359267 5:122627647-122627669 CCCTCTCCACACTCTTCATGTGG + Intergenic
997872123 5:137515438-137515460 CCACCTCCAAGCCTTTCATCCGG + Intronic
998278750 5:140784020-140784042 CAAGCACCAAGCCATTCATGAGG - Intergenic
998876750 5:146607931-146607953 CCATATGCAAAGCCTTCATGTGG - Intronic
999073526 5:148773026-148773048 CCATCTCCGAGCCCATCTGGAGG + Intergenic
1000240060 5:159400909-159400931 ACATCCCCACCCCCTTCATGGGG - Intergenic
1001574853 5:172756671-172756693 ACAGCACCAAGCCATTCATGAGG + Intergenic
1001879263 5:175229122-175229144 ACAGCACCAAGCCATTCATGAGG + Intergenic
1003435550 6:6084710-6084732 CAGTCTCCAACCCCTTCATATGG - Intergenic
1003788917 6:9520591-9520613 ACAGCACCAAGCCATTCATGAGG + Intergenic
1004454906 6:15783418-15783440 CCATCTCCGTGCCCATGATGAGG - Intergenic
1004552445 6:16661890-16661912 CTAGCTCCAAGTCTTTCATGAGG - Intronic
1004692639 6:18005537-18005559 CCATCAGCAAGCGCTTCATGTGG - Intergenic
1004959588 6:20771684-20771706 ACAGCACCAAGCCATTCATGAGG - Intronic
1005946911 6:30602088-30602110 CCGTGTCCAGGGCCTTCATGGGG + Exonic
1006245324 6:32729325-32729347 ACATCTCAAAGTCATTCATGAGG - Intergenic
1007182305 6:39938248-39938270 ACAGCACCAAGCCATTCATGAGG - Intergenic
1009281860 6:61762448-61762470 ACAGCACCAAGCCATTCATGAGG - Intronic
1010508578 6:76689583-76689605 ACAGCACCAAGCCATTCATGAGG - Intergenic
1011012154 6:82714809-82714831 ACAGCACCAAGCCATTCATGAGG + Intergenic
1011323314 6:86121180-86121202 CCAGCACCAAGCCATTTATGTGG - Intergenic
1013449698 6:110267953-110267975 ACAGCACCAAGCCATTCATGAGG + Intronic
1013875062 6:114815448-114815470 GCAACACCAAGCCATTCATGAGG - Intergenic
1013994715 6:116294883-116294905 CCATCTCAAAGCCCTAAAGGTGG + Intronic
1015942042 6:138462440-138462462 ACATCACCAAGCTATTCATGAGG + Intronic
1016307993 6:142703346-142703368 CCATCTCCAAACCCGTCTGGTGG + Intergenic
1016318115 6:142812093-142812115 CCATCTCCAAGTCCTCCACTCGG - Intronic
1017441407 6:154467406-154467428 GCATCTGTAAGCCCTCCATGAGG - Intronic
1018291066 6:162292979-162293001 CCTCCTCCTTGCCCTTCATGAGG - Intronic
1019394272 7:808602-808624 CCACCTCCAAGGTCTTCCTGTGG - Intergenic
1021403916 7:20241851-20241873 ACAACACCAAGCCCTTCATGAGG - Intergenic
1022404810 7:30078873-30078895 CCCTCTCCAACCCCTTCACCTGG + Exonic
1022886620 7:34653421-34653443 ACAGCACCAAGCCCTTCATGAGG + Intergenic
1023121650 7:36915491-36915513 CCATCTCTAAGGCCTGAATGGGG - Intronic
1024850237 7:53705800-53705822 CCATCTCAAAGCCTTTCAAGAGG - Intergenic
1026028952 7:66772407-66772429 CCATTTCCAAGCCCTGCAGTGGG - Intronic
1026571238 7:71532966-71532988 CCACCTACAAACCCTGCATGAGG + Intronic
1026761577 7:73130859-73130881 CCATCTCAGAGCGTTTCATGGGG - Intergenic
1027037917 7:74939675-74939697 CCATCTCAGAGCGTTTCATGGGG - Intergenic
1027085644 7:75261800-75261822 CCATCTCAGAGCGTTTCATGGGG + Intergenic
1028479063 7:91284762-91284784 ACAGCACCAAGCCATTCATGAGG + Intergenic
1029036186 7:97524747-97524769 ACAGCACCAAGCCATTCATGAGG + Intergenic
1029177233 7:98673539-98673561 ACAGCACCAAGCCATTCATGAGG + Intergenic
1031559169 7:123216819-123216841 CCAGTGCCAAGCCATTCATGAGG - Intergenic
1031985995 7:128165151-128165173 CCATCTCCATGTGCTCCATGTGG - Intergenic
1032193667 7:129778255-129778277 CCCTCTCCCAGCACCTCATGGGG - Intergenic
1032475288 7:132207590-132207612 CCATTTCCAACCCCATTATGCGG - Intronic
1032481533 7:132250982-132251004 CCATCCCCAAGCCCAGCAGGTGG + Intronic
1033952406 7:146801265-146801287 ACAGCACCAAGCCATTCATGAGG + Intronic
1034066166 7:148138794-148138816 CCAACTGCAAGTCCTACATGGGG + Intronic
1035932658 8:3800652-3800674 ATATCACCAAGCCGTTCATGAGG - Intronic
1036281005 8:7401513-7401535 ACAGCACCAAGCCATTCATGAGG - Intergenic
1036340460 8:7910059-7910081 ACAGCACCAAGCCATTCATGAGG + Intergenic
1037334620 8:17780067-17780089 ACAGCCCCAAGCCATTCATGAGG - Intronic
1038701694 8:29855141-29855163 ACATCACCAAGCTATTCATGAGG - Intergenic
1039158852 8:34594944-34594966 ACATCTCCAAGCCATTCATGAGG + Intergenic
1039491914 8:37954075-37954097 ACAGCACCAAGCCATTCATGAGG - Intergenic
1040033563 8:42847401-42847423 ACAACTCAAAGCCATTCATGAGG + Intergenic
1042103336 8:65297714-65297736 CCACATCCCAGCCCTCCATGAGG + Intergenic
1043340906 8:79237832-79237854 CCAATTCAAATCCCTTCATGTGG - Intergenic
1045340160 8:101246624-101246646 CCTACACCAAGCCTTTCATGAGG + Intergenic
1046580015 8:116080719-116080741 GCAAATCCAAGCCCTTCCTGTGG + Intergenic
1047562356 8:126001328-126001350 ACAGCACCAAGCCATTCATGAGG + Intergenic
1048201994 8:132382272-132382294 ACAGCACCAAGCCATTCATGAGG - Intronic
1049054406 8:140224120-140224142 CCCTCTTCAAGCACTGCATGTGG + Intronic
1049627453 8:143631902-143631924 CCATGTCCAAGCCCTGCCTCCGG + Intergenic
1050074972 9:1853775-1853797 ACAGCACCAAGCCATTCATGAGG - Intergenic
1050368286 9:4893993-4894015 AAATCTCCAAATCCTTCATGTGG + Intergenic
1051307350 9:15726157-15726179 GCAATTCCAACCCCTTCATGTGG - Intronic
1053438649 9:38095319-38095341 ACAGCACCAAGCCATTCATGAGG - Intergenic
1053470248 9:38341211-38341233 TCATCAGCAAGCCATTCATGAGG + Intergenic
1055858444 9:80720242-80720264 ACAGCACCAAGCCATTCATGAGG - Intergenic
1056671075 9:88627321-88627343 CCAGCTCCCACCCCTACATGAGG - Intergenic
1056835632 9:89953054-89953076 ACAGCACCAAGCCATTCATGAGG - Intergenic
1057551949 9:96057492-96057514 ACAGCACCAAGCCATTCATGAGG - Intergenic
1058535719 9:105958056-105958078 ACAGCACCAAGCCATTCATGAGG + Intergenic
1059266324 9:113034788-113034810 ACAGCACCAAGCCATTCATGAGG - Intergenic
1061023446 9:128031998-128032020 CCTGCACCAAGCCATTCATGAGG - Intergenic
1062074325 9:134576198-134576220 CCATCTCCAAGACTCTCCTGTGG + Intergenic
1062200603 9:135300781-135300803 CCAGCCCCAAGCCCTCCATCTGG - Intergenic
1185650687 X:1645875-1645897 CCACCTCCAACCCCTTCAGTAGG - Intergenic
1186188322 X:7043269-7043291 GCAGCACCAAGCCATTCATGAGG - Intergenic
1186317642 X:8387914-8387936 CCAACACCAAGCCATTCATGAGG - Intergenic
1186529670 X:10282496-10282518 ACAGCACCAAGCCATTCATGAGG + Intergenic
1186656368 X:11616067-11616089 ACAGCACCAAGCCATTCATGAGG - Intronic
1186958121 X:14705228-14705250 CCCACTCCAAGACCTTCAAGAGG + Intronic
1188351768 X:29140194-29140216 CATTCTCCAAGCCATTTATGAGG + Intronic
1188366809 X:29325967-29325989 ACAGCACCAAGCCATTCATGAGG + Intronic
1189276551 X:39790663-39790685 CCAACACCAAGCCATTCATGAGG + Intergenic
1189349057 X:40263507-40263529 CCAACTCCAAGCCTTTGATGGGG + Intergenic
1189544143 X:42024241-42024263 ACAGCACCAAGCCCTTCATGAGG + Intergenic
1189735719 X:44067676-44067698 ACAGCACCAAGCCATTCATGAGG + Intergenic
1191098018 X:56695053-56695075 ACAGCACCAAGCCATTCATGAGG + Intergenic
1191759483 X:64630842-64630864 CCAACTCCAAGCCCTCGATATGG + Intergenic
1193793165 X:85841205-85841227 CCAGCTCTTGGCCCTTCATGTGG - Intergenic
1193892355 X:87065557-87065579 GCAGCACCAAGCCATTCATGGGG + Intergenic
1193944307 X:87713692-87713714 ACAGCACCAAGCCATTCATGAGG - Intergenic
1194373871 X:93109339-93109361 ACAACACCAAGCCATTCATGAGG + Intergenic
1195458737 X:105099820-105099842 ACAGCACCAAGCCATTCATGAGG + Intronic
1195659469 X:107363863-107363885 ACAGCACCAAGCCATTCATGAGG + Intergenic
1196210923 X:112994866-112994888 CCACCTCCAATCCATTCATAAGG - Intergenic
1196343562 X:114625370-114625392 ACAGCACCAAGCCATTCATGAGG - Intronic
1196376090 X:115034094-115034116 ACAGCACCAAGCCATTCATGAGG - Intergenic
1198313499 X:135443949-135443971 GCAGCACCAAGCCATTCATGAGG + Intergenic
1200254997 X:154575903-154575925 ACAGCACCAAGCCATTCATGAGG - Intergenic
1200257815 X:154594077-154594099 ACAACCCCAAGCCCTTCATGAGG - Intergenic
1200262772 X:154628505-154628527 ACAGCACCAAGCCATTCATGAGG + Intergenic
1200681900 Y:6223401-6223423 ACAACACCAAGCCATTCATGAGG + Intergenic