ID: 1183704557

View in Genome Browser
Species Human (GRCh38)
Location 22:39468906-39468928
Sequence GAAACTTCTGTGCCTCCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 200}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183704551_1183704557 25 Left 1183704551 22:39468858-39468880 CCGAATCCTCCAGGAACAGGCAC 0: 1
1: 0
2: 1
3: 19
4: 166
Right 1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 200
1183704554_1183704557 16 Left 1183704554 22:39468867-39468889 CCAGGAACAGGCACGGAGATTGA 0: 1
1: 0
2: 0
3: 14
4: 298
Right 1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 200
1183704553_1183704557 19 Left 1183704553 22:39468864-39468886 CCTCCAGGAACAGGCACGGAGAT No data
Right 1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG 0: 1
1: 0
2: 0
3: 13
4: 200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183704557 Original CRISPR GAAACTTCTGTGCCTCCTTG AGG Intronic
900590104 1:3455614-3455636 GAATCTTCTCTGTGTCCTTGAGG + Intronic
900831966 1:4971888-4971910 GACACCTCCGTGCCTCCCTGGGG + Intergenic
901704372 1:11062191-11062213 TCAAGTTCTGTGCCTGCTTGAGG - Intergenic
902832839 1:19028834-19028856 CAGACTTCTGTGGCTCCCTGAGG - Intergenic
904605882 1:31697360-31697382 GACATCTCTGTGCCTCCTGGGGG - Intronic
906045803 1:42830215-42830237 AAAAGAACTGTGCCTCCTTGTGG - Intronic
906820246 1:48921721-48921743 GAAAGTTATTTACCTCCTTGAGG - Intronic
906923263 1:50087550-50087572 GAAAATTCAGTGTCTACTTGAGG - Intronic
908816371 1:68039631-68039653 TAAGCTTCTGTGCCCCATTGGGG + Intergenic
914980614 1:152411370-152411392 GAAACATCTGGGCCTCAATGAGG - Intronic
916198402 1:162246858-162246880 ACAACTTCTCTGCTTCCTTGAGG - Intronic
919383608 1:196890869-196890891 GAAACTCCAGTGCCTTCTAGTGG + Intronic
920029727 1:203029239-203029261 GCAACCTCGGGGCCTCCTTGAGG + Intronic
920950757 1:210569893-210569915 GAAACATCTGTGCTTGCCTGGGG - Intronic
1066678515 10:37913769-37913791 GAAACTCCTTTGGCTCCTTCAGG - Intergenic
1068518296 10:58050889-58050911 TAAGCTTCTGTACCTCATTGGGG + Intergenic
1068686793 10:59878773-59878795 GAGATTTCAGTGCCTCCATGGGG + Intronic
1070682369 10:78457366-78457388 GAAATTTCTGTGCCTCATGGTGG + Intergenic
1070792308 10:79196713-79196735 TAAGCTCCTGTGCCTGCTTGGGG + Intronic
1074281013 10:112051478-112051500 AAAACTTCTTTGCCTCCAGGTGG + Intergenic
1075921952 10:126220923-126220945 GAAGCCTCTGGGCCTCCATGTGG - Intronic
1076883498 10:133251077-133251099 CAGCCTTCTGTGGCTCCTTGAGG - Intergenic
1077452851 11:2661398-2661420 GGGACTCCTGTGCCTCATTGGGG + Intronic
1078664861 11:13315986-13316008 GAAACATCTGTGCCTTGTTAAGG + Intronic
1081570288 11:44286486-44286508 GGAACTGCAGTGCCTCCTGGTGG - Intronic
1083315856 11:61814870-61814892 GAGACTTCCGTCCCTTCTTGCGG + Intronic
1085311913 11:75521941-75521963 GAAGCCTCTGTGGCTCCTTACGG - Intronic
1085653989 11:78295710-78295732 AAAACTTCTGTGACTCCTCGAGG - Intronic
1086496681 11:87411185-87411207 CTAACTTCTATGCCTCCTTCAGG + Intergenic
1086508706 11:87531999-87532021 TAAGCTTCTGTTCCCCCTTGGGG + Intergenic
1086754797 11:90546790-90546812 CAAACTTCTGTCTCTCCTTTAGG - Intergenic
1087235690 11:95716024-95716046 GAAACATCTGTGTCTCTTTCAGG - Intergenic
1090965642 11:131595718-131595740 CAAGCTTCTGTGCCTCCTATTGG + Intronic
1095479706 12:42622371-42622393 GAAACTTCTATACCATCTTGAGG + Intergenic
1095969852 12:47894211-47894233 GCAACTTCTTTCCCTCCTGGTGG + Intronic
1098234475 12:68405700-68405722 GAAATTTGTTTGCCTGCTTGTGG - Intergenic
1098524411 12:71470069-71470091 AAACCTTCAGTGCCTCCTGGGGG + Intronic
1101217667 12:102600917-102600939 TAATCTTCTGGGCCTCTTTGGGG + Intergenic
1101440894 12:104703663-104703685 GAAAGCTCAGAGCCTCCTTGTGG + Intronic
1101734145 12:107450430-107450452 GAAGCTTCTATACCACCTTGGGG + Intronic
1102669529 12:114605654-114605676 GAAAGTTCTTTGTCTTCTTGAGG - Intergenic
1104848446 12:131858869-131858891 GAGACTTCTGTGGGTCCTTGAGG + Intergenic
1106789139 13:33136971-33136993 GAAACTTCTGTGCCTGGCAGGGG - Intronic
1106902186 13:34365523-34365545 GGAACTTCTCAGCTTCCTTGAGG - Intergenic
1111036347 13:82679150-82679172 AAAACTTATGCTCCTCCTTGTGG + Intergenic
1114921502 14:27337232-27337254 GAAAATTCTGTACCTCTCTGAGG + Intergenic
1115764918 14:36613792-36613814 GCAATTTCCGTTCCTCCTTGTGG - Intergenic
1118919359 14:70136071-70136093 AAAACTTCTGTGCCTCAGAGTGG + Intronic
1119776897 14:77254625-77254647 GGAACTTCTGAGCCTCCATTTGG - Intronic
1120927348 14:89810984-89811006 GAACCTTCTGTCACTCCTTCAGG - Intronic
1121445231 14:93974476-93974498 GATATTTTTGTGCCTCCTTTGGG + Intronic
1122093840 14:99357132-99357154 GAAGATTCTTTCCCTCCTTGAGG - Intergenic
1124391274 15:29260108-29260130 GAAACGTCTGGGCCTATTTGGGG + Intronic
1125740608 15:41961078-41961100 GAAACTGCTGTGCCTACTAAGGG + Intronic
1127604067 15:60568354-60568376 GAAACTTCAGCACCTCCATGAGG + Intronic
1128409834 15:67384074-67384096 GATGCTTCAATGCCTCCTTGTGG - Intronic
1128977651 15:72165277-72165299 GAGGCTTCTGGGCCTCCTAGGGG - Intronic
1130005330 15:80091075-80091097 GCAACTTCTCTTCCTCCTAGTGG - Intronic
1130901051 15:88207006-88207028 GAACCTTCTGTTCCTCCTTCAGG + Intronic
1131266053 15:90916063-90916085 GAAAGGTCAGTGCCTGCTTGGGG + Intronic
1131413431 15:92230377-92230399 AGAACTTCTGGGCCTTCTTGGGG + Intergenic
1132466815 16:81391-81413 CACACTCCTGTGCCTCCATGGGG - Intronic
1133226151 16:4341406-4341428 GAATCTGCTGTGCCTCCTGGAGG + Exonic
1134248372 16:12556818-12556840 CAAACTTCTGTTCCTCCTCTGGG - Intronic
1135461475 16:22647274-22647296 GCAACTTCTGTGACTCAGTGTGG + Intergenic
1137599620 16:49747742-49747764 TAAAATTCTGTGCTTCCCTGTGG - Intronic
1138101809 16:54258001-54258023 AAAACACCTGTCCCTCCTTGTGG + Intronic
1138528381 16:57621622-57621644 CACACTGCTGTGCCACCTTGTGG + Intronic
1140727188 16:77824133-77824155 CAAACTTCTGTCCTTCCTTTAGG - Intronic
1141739426 16:85881060-85881082 GGAACTTCTGTGACTCTTAGTGG - Intergenic
1143352864 17:6301697-6301719 AAGACTTCTGTGCCTGCTTGGGG - Intergenic
1144372704 17:14607241-14607263 GAACCTTCAGTGCCTCGTTCAGG + Intergenic
1145395834 17:22494070-22494092 GAAACTTATGTGACTCGTAGTGG + Intergenic
1145858357 17:28184460-28184482 CAAGCTTCTGTACCTCATTGGGG + Intronic
1150401299 17:64858778-64858800 TATACTTCTCTGCCTCATTGAGG - Exonic
1150847242 17:68671820-68671842 GAAAGATCTGTGCTTGCTTGGGG + Intergenic
1151060553 17:71088198-71088220 GGAACTTCTGTGACTTCTTTCGG - Intergenic
1151351535 17:73534852-73534874 GCATCTTCTAGGCCTCCTTGTGG + Intronic
1151977837 17:77492453-77492475 CCAACTCCTGTGCCTCCTGGAGG - Intronic
1152692714 17:81727440-81727462 GAAACTTCTCTGCCAGCTTGTGG + Intergenic
1154113144 18:11587551-11587573 GAAACTTCTAGGCCATCTTGAGG + Intergenic
1160512682 18:79461271-79461293 GAAACGTCTGTGACTCTGTGTGG - Intronic
1161507538 19:4652025-4652047 GCATCTTCTGGGCCTCCTTGCGG - Exonic
1161551746 19:4916796-4916818 GAAACTGCTCTGCCTTCCTGAGG - Intronic
1161792460 19:6368569-6368591 CAAACTCCTGGGCCTCCATGGGG - Exonic
1162752058 19:12834952-12834974 GGCCCTTCTGAGCCTCCTTGGGG + Intronic
1163491863 19:17621526-17621548 TGAAATTCTGTGCCTTCTTGAGG - Intronic
1163568066 19:18063559-18063581 AAGACTTCTCTGCCTCCTTCTGG - Intronic
1163774745 19:19211668-19211690 GAAGCGACTTTGCCTCCTTGGGG + Intergenic
1164921975 19:32095099-32095121 GGAGCTGCTGTCCCTCCTTGGGG - Intergenic
1165250594 19:34530726-34530748 GAATCTTGTGTGTCTCCTGGAGG + Intergenic
1166001797 19:39881866-39881888 GAAACCTCTGTGCCACCCAGTGG + Intronic
1166004578 19:39898117-39898139 GAAACCTCTGTGCCACCCAGTGG + Intronic
1166509698 19:43396608-43396630 TAAACCTCTGTTCCTCCTTCAGG - Intergenic
1168415110 19:56162789-56162811 GGGACTTCTGTGCCCCTTTGGGG + Intergenic
925014798 2:514579-514601 GAACCTGGTGTGGCTCCTTGAGG + Intergenic
926159999 2:10481238-10481260 AAAAGATCTGTGCCTCTTTGAGG + Intergenic
927057339 2:19377910-19377932 GACAGTGCAGTGCCTCCTTGTGG + Intergenic
932446428 2:71784618-71784640 AAAAGTTCTGTGCCTCCCTCTGG - Intergenic
932514114 2:72327167-72327189 GTAACTTCTGGACCTCTTTGAGG - Intronic
936677222 2:114729386-114729408 GAAACCTCTGAGCCTCTTCGGGG + Intronic
936969239 2:118161024-118161046 GAACCTTATGTGCCATCTTGAGG + Intergenic
937467405 2:122146630-122146652 GACATTTATGTCCCTCCTTGAGG - Intergenic
937958327 2:127436416-127436438 AGAACTTCTGTACCTCCTGGAGG + Intronic
938252122 2:129823304-129823326 GACACTGCTGTGCCTGCCTGTGG - Intergenic
940776074 2:157885204-157885226 TAGAGTTCTGTGCTTCCTTGAGG - Intronic
940853632 2:158711989-158712011 GAAACTTATGTGTCTCCTAATGG - Intergenic
942897651 2:181076842-181076864 TTAACTTCTGCACCTCCTTGTGG - Intergenic
943758476 2:191583892-191583914 GAAACTTCTCTGTCTGTTTGGGG - Intergenic
943805154 2:192115093-192115115 GAAACTTTTGTGGCTCCATATGG - Intronic
944736767 2:202574235-202574257 GCAACCTCTCTGCCTCCCTGTGG + Intergenic
946277236 2:218640733-218640755 GGTACTTCCGTTCCTCCTTGTGG + Exonic
947743598 2:232496536-232496558 GAAACTGCTGCTCCTCCATGGGG + Intergenic
1170480490 20:16760538-16760560 GAAACCTATGTGTCTGCTTGCGG - Intronic
1172111432 20:32547653-32547675 GCAACTTGGGTGCTTCCTTGGGG - Intronic
1172666221 20:36602177-36602199 GAAGCTTCTGTACCTTATTGGGG - Intronic
1172666265 20:36602504-36602526 GAAGCTTCTGTACCATCTTGAGG + Intronic
1172886354 20:38233700-38233722 TAACCTTCTATGGCTCCTTGTGG + Intronic
1173159714 20:40643382-40643404 GAAACATCTGTCCCTTCTTTTGG - Intergenic
1175296926 20:57914975-57914997 GAAACTTCTCAGCCTCCATAAGG - Intergenic
1175456417 20:59118371-59118393 GAAATTTTTGTGCCACGTTGAGG - Intergenic
1176287565 21:5026536-5026558 GAAACTTCTGCTCGTCCTGGGGG - Exonic
1179406621 21:41131765-41131787 GAGACTTCTGCTCCTCCTTCTGG + Intergenic
1179514333 21:41896438-41896460 GAAACTTTTGTGCTTACTTGTGG + Intronic
1179869616 21:44236939-44236961 GAAACTTCTGCTCGTCCTGGGGG + Exonic
1180891294 22:19291300-19291322 GGAATTTGTGTGCCTCCTCGCGG + Intronic
1182268487 22:29137677-29137699 AAGACATCTTTGCCTCCTTGGGG + Intronic
1183704557 22:39468906-39468928 GAAACTTCTGTGCCTCCTTGAGG + Intronic
1184286123 22:43472691-43472713 AAAACTTCTGTCTCGCCTTGGGG + Intronic
1184461923 22:44643013-44643035 GAAACTTCAGTGGCTTCTTCAGG - Intergenic
1185020687 22:48372996-48373018 GACACTTCTGTTCTTCCTGGGGG - Intergenic
953017841 3:39095471-39095493 GAAACTGCTGCACCTCCCTGGGG - Exonic
953128308 3:40112691-40112713 CAAACTTTTGTGCCTCCATAAGG + Intronic
955507260 3:59644860-59644882 GAACCCTCTGTGCCCGCTTGGGG - Intergenic
957063184 3:75498829-75498851 GAACCTTCTTTTCCTCCATGTGG - Intergenic
961378746 3:126483468-126483490 GAAACTCCTCTGCCTCCTGCAGG - Exonic
961896882 3:130175278-130175300 GAAACTTGTTTTCCTCCATGTGG - Intergenic
966985945 3:185180542-185180564 AACACTTCTGTATCTCCTTGGGG - Intergenic
968453444 4:685888-685910 GAACCCTCTGGGCGTCCTTGTGG - Exonic
968897276 4:3411967-3411989 GAAACTTCAGTGCGTGCTGGCGG + Intronic
968954386 4:3710821-3710843 GAAGGTTCTGGTCCTCCTTGCGG + Intergenic
968977371 4:3829038-3829060 GGAGCATCTGTGCCTCCTGGGGG - Intergenic
969746546 4:9077228-9077250 GAAACTTGTTTTCCTCCATGTGG + Intergenic
969930822 4:10629132-10629154 TAAACTTCTGCGCCTCATTGAGG + Intronic
977591176 4:98828995-98829017 GACTCTTCTGTGCCCCCTTTTGG + Intergenic
981589401 4:146341684-146341706 AAAAGTTCTCTGCCTTCTTGGGG + Intronic
982266353 4:153541893-153541915 TCAACTTCTTTGCTTCCTTGTGG + Intronic
983660970 4:170130608-170130630 GAAATTTCTGTGCCCCATTGTGG + Intergenic
985644708 5:1079443-1079465 TGGACTTCTGTGCATCCTTGAGG + Exonic
990861589 5:60333524-60333546 GAACCTTCTGAGCCTCCACGTGG - Intronic
992480471 5:77146531-77146553 GAAAGCTCTGTGCCTCACTGAGG + Intergenic
995541263 5:113188315-113188337 GAATCTTTTTTGCCTCCTTTTGG - Intronic
995883250 5:116865930-116865952 GAAGCTTATGTACCACCTTGAGG - Intergenic
996513531 5:124344454-124344476 TAAATTTCTGTACCTCATTGGGG - Intergenic
998500280 5:142626715-142626737 GTCACTCCTGTGCCTCCTTTAGG + Intronic
998771252 5:145548634-145548656 GCCACTTCTGTCCATCCTTGTGG + Intronic
999801641 5:155043950-155043972 CAAGCTTCTGTACCTCATTGAGG + Intergenic
1002239010 5:177823629-177823651 GAAATTGCTGTGTCTACTTGGGG - Intergenic
1002560863 5:180081203-180081225 GAAGCTTGTGTTCTTCCTTGAGG - Intergenic
1005662714 6:28015640-28015662 GAAAATGCTGTGCCTCCTCCTGG - Intergenic
1006730921 6:36235676-36235698 GAAACTTCTGCCCCACCTTTTGG - Intergenic
1007206669 6:40158172-40158194 GTAACTTCTGTAACTCCTTAAGG - Intergenic
1007298317 6:40845789-40845811 GTGTCTTCTGCGCCTCCTTGTGG + Intergenic
1008197972 6:48548709-48548731 GAAACTTATGTGCCAGCTTATGG - Intergenic
1009537753 6:64911379-64911401 GAAACTTCTGGGCCTTCTGAAGG - Intronic
1011734872 6:90300303-90300325 GAAGCTTCTCAGCTTCCTTGTGG - Intergenic
1012427995 6:99135143-99135165 CAAACATCTCTGCCTCCCTGGGG + Intergenic
1012519425 6:100103249-100103271 GACACTTCTCTGCCCTCTTGGGG + Intergenic
1014389056 6:120838097-120838119 GAAATCTGTGTGCTTCCTTGAGG - Intergenic
1014717787 6:124886372-124886394 GAACCTTCTGGACCTCCCTGAGG - Intergenic
1015424696 6:133052273-133052295 CAAGCTGCTATGCCTCCTTGAGG + Intergenic
1016411509 6:143788084-143788106 ACAACTTCGGTTCCTCCTTGTGG - Intronic
1018520060 6:164639136-164639158 GAGACACCTGGGCCTCCTTGAGG - Intergenic
1019761007 7:2812754-2812776 GTAACGTCTGTGCCTTCATGTGG - Intronic
1019846773 7:3510552-3510574 GAAACTTCTGTGCACTTTTGAGG + Intronic
1020327568 7:6986952-6986974 GAAACTTGTTTTCCTCCATGTGG - Intergenic
1021361095 7:19713111-19713133 GAAGCTTCTGAGCCTCTCTGAGG - Intergenic
1023818779 7:43968935-43968957 CAAACCACTGTCCCTCCTTGGGG + Intergenic
1024361581 7:48474248-48474270 GAAATTTCTGCACCTCTTTGGGG - Intronic
1024912596 7:54463178-54463200 GGCAATTGTGTGCCTCCTTGGGG - Intergenic
1025575432 7:62633955-62633977 GAGACATTTGTGCCACCTTGAGG - Intergenic
1029743828 7:102505901-102505923 CAAACCACTGTCCCTCCTTGGGG + Intronic
1029761815 7:102605064-102605086 CAAACCACTGTCCCTCCTTGGGG + Intronic
1033563131 7:142553184-142553206 GAATCTTCTGAGCCCACTTGAGG + Intergenic
1038076737 8:24084352-24084374 TAAGCTTCTGTACCTCGTTGGGG - Intergenic
1038205981 8:25465710-25465732 GGAACTTCTGTGTCTCGTTCTGG + Intronic
1038342555 8:26699314-26699336 GAAGCTTCTGTGCATATTTGTGG + Intergenic
1038858035 8:31354350-31354372 GAAATATCTCTGCCACCTTGAGG + Intergenic
1040997608 8:53417902-53417924 GAAGCTTATGTGCCAACTTGAGG - Intergenic
1041934166 8:63318345-63318367 AAAAGTTCTGTGTCTCCTGGTGG - Intergenic
1044203651 8:89466192-89466214 GAAACTTCAGTGGCTACCTGAGG - Intergenic
1046048150 8:108987557-108987579 AGGACTTCTGTGTCTCCTTGTGG - Intergenic
1049821245 8:144634956-144634978 GTAACTTCTGTCTCTCCTTCAGG + Intergenic
1049987570 9:965996-966018 GAAACTTCTGTCACTGGTTGGGG + Intronic
1051220325 9:14842242-14842264 GAACCTTCTATGCATCCTTCTGG - Intronic
1051353839 9:16223270-16223292 GAAAATTCCCTGACTCCTTGCGG - Intronic
1051675332 9:19553018-19553040 GAAACTTCACAGCCTCCTGGGGG + Intronic
1052600321 9:30619628-30619650 GAATTTTCTGTTCCTTCTTGAGG + Intergenic
1060937337 9:127523120-127523142 GAAACTTCACTGCCTCCCTCAGG - Intronic
1061436209 9:130563791-130563813 GAAACTTCTGTTGGTCCCTGTGG + Intergenic
1062025428 9:134338127-134338149 GACACCTCTGTCCCTCCCTGTGG - Intronic
1062285353 9:135770292-135770314 GAGACTCCTGTCCCTCCCTGTGG - Exonic
1189652606 X:43206595-43206617 TAAGCTTTTGTACCTCCTTGGGG + Intergenic
1190819724 X:53962040-53962062 GAAACCTTTCTGCCACCTTGTGG + Intronic
1191116516 X:56858479-56858501 GAAACTTTGGAACCTCCTTGAGG - Intergenic
1193350732 X:80462045-80462067 GAGACTTCAGGGCCTACTTGAGG - Intergenic
1195132035 X:101862663-101862685 TAAACTTTTCTGCCTCCTGGAGG - Intergenic
1195245372 X:102990546-102990568 GGAACTTTTGTGCCTTCCTGGGG + Intergenic
1195581165 X:106504158-106504180 GAAACTTCTGTTTCTCCTTACGG + Intergenic
1196222194 X:113124660-113124682 GAAACTTATATGCCATCTTGAGG + Intergenic
1196439093 X:115702256-115702278 GGAACTTCTGTGCCTTCTCCTGG - Intergenic
1197641024 X:128968211-128968233 TAAATTTCTGTGCCTGCTTATGG + Intergenic
1197652981 X:129086056-129086078 TAATCTTCTGTGCCCCATTGGGG + Intergenic
1197869681 X:131053199-131053221 GCAATTTCTCTGCCTCCTTGGGG + Intergenic