ID: 1183705582

View in Genome Browser
Species Human (GRCh38)
Location 22:39473340-39473362
Sequence AAGTATCCACACATGGAGAC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 266}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183705573_1183705582 12 Left 1183705573 22:39473305-39473327 CCCTCATGCTGCGTCATCCCATG 0: 1
1: 25
2: 210
3: 523
4: 1399
Right 1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG 0: 1
1: 0
2: 0
3: 19
4: 266
1183705579_1183705582 -6 Left 1183705579 22:39473323-39473345 CCATGGCAGAAGGGCAGAAGTAT 0: 1
1: 0
2: 1
3: 17
4: 257
Right 1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG 0: 1
1: 0
2: 0
3: 19
4: 266
1183705578_1183705582 -5 Left 1183705578 22:39473322-39473344 CCCATGGCAGAAGGGCAGAAGTA 0: 1
1: 0
2: 8
3: 33
4: 267
Right 1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG 0: 1
1: 0
2: 0
3: 19
4: 266
1183705574_1183705582 11 Left 1183705574 22:39473306-39473328 CCTCATGCTGCGTCATCCCATGG 0: 1
1: 4
2: 17
3: 57
4: 283
Right 1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG 0: 1
1: 0
2: 0
3: 19
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183705582 Original CRISPR AAGTATCCACACATGGAGAC GGG Intronic
900271830 1:1794208-1794230 CAATATCCACACATGATGACTGG + Intronic
901712786 1:11128843-11128865 AAGTATCCTCACCTGTAGCCAGG + Exonic
904032785 1:27543545-27543567 AGGTTTGCACACATGGAGACCGG - Intronic
905114484 1:35625611-35625633 AAGTAGCCAGGCATGGTGACGGG + Intronic
908697775 1:66864462-66864484 AGGTGTCAACAGATGGAGACTGG + Intronic
909173130 1:72319803-72319825 AAATAGCCACACATGGCGAGTGG + Intergenic
915536945 1:156542336-156542358 AATTAGCCAGACATGGTGACAGG - Intronic
918966917 1:191362702-191362724 AAATATCCACACCTGGAAATGGG + Intergenic
919718890 1:200810590-200810612 AAGAATACAGACTTGGAGACTGG + Intronic
920413593 1:205782354-205782376 AAATAACCACACATGGCTACTGG - Intergenic
920502276 1:206492928-206492950 TCGGATCCACACATGGACACAGG - Exonic
920663615 1:207941930-207941952 AGGCATCCAGACATGGAAACTGG - Intergenic
921003707 1:211070673-211070695 AAGTAGCCAGGCATGGTGACGGG + Intronic
921521623 1:216162772-216162794 AAGGATGCACACATGGAGTTTGG - Intronic
921651689 1:217686865-217686887 AATTATCCAGACATGGTGGCAGG - Intronic
922663601 1:227450596-227450618 AAGAGTCCACACAAGGAGAGAGG - Intergenic
922744267 1:228035555-228035577 AGGGATGCACACATGGGGACCGG - Intronic
922872612 1:228915587-228915609 AAATATCCAAGCTTGGAGACTGG - Intergenic
923140519 1:231158584-231158606 AATTATCCAGACATGGTGGCAGG - Intergenic
1063096905 10:2916171-2916193 AAGTAACCAGAAGTGGAGACAGG - Intergenic
1063135924 10:3216145-3216167 ATGTATACACACATGCACACAGG + Intergenic
1063188900 10:3675224-3675246 AATTAGCCAGACATGGTGACAGG + Intergenic
1063562887 10:7146677-7146699 AATTAGCCACGCATGGTGACGGG - Intergenic
1063972673 10:11392364-11392386 AAGTATCCAGGCATGGTGGCGGG + Intergenic
1063975975 10:11415882-11415904 AAGTATCCAGGCATGGTGGCGGG - Intergenic
1064308601 10:14190723-14190745 AAGTCTACTCACAAGGAGACAGG + Intronic
1065198994 10:23296148-23296170 AAATATCGACACATGCATACAGG - Intronic
1066674854 10:37877258-37877280 AATTAGCCAGACATGGTGACAGG - Intergenic
1066929182 10:41735367-41735389 AAGTATCCCCACATAGAAACTGG + Intergenic
1067330267 10:45309191-45309213 ACGTGTCCACACCTGGGGACTGG + Intronic
1067735995 10:48851294-48851316 AAGCATCCACATATGGAGGAGGG - Intronic
1069086441 10:64145156-64145178 AAGTCTCAACACATGGATTCTGG + Intergenic
1069476267 10:68735551-68735573 AATGAGCCACACATGGAGGCAGG - Intronic
1070070951 10:73088678-73088700 AAGTATCCACTGTTGGACACTGG - Intronic
1071357340 10:84811424-84811446 AAATATCCCCACATGGTCACGGG + Intergenic
1073614322 10:104977665-104977687 AAGTATCAAAATATGTAGACAGG + Intronic
1074422104 10:113318089-113318111 ACGTATGCACACATGCACACAGG - Intergenic
1075035829 10:119066358-119066380 AATTAGCCAGACATGGTGACAGG + Intronic
1075455277 10:122580973-122580995 CAGTATCCACACAGAGAAACAGG - Intronic
1075457398 10:122593676-122593698 CAGTATCCACACAGAGAAACAGG - Intronic
1075458473 10:122600171-122600193 CAGTATCCACACAGAGAAACAGG - Intronic
1075458977 10:122603207-122603229 CAGTATCCACACAGAGAAACAGG - Intronic
1075459609 10:122607266-122607288 CAGTATCCACACAGAGAAACAGG - Intronic
1075460241 10:122611325-122611347 CAGTATCCACACAGAGAAACAGG - Intronic
1075460873 10:122615384-122615406 CAGTATCCACACAGAGAAACAGG - Intronic
1077204290 11:1334775-1334797 AATTAGCCACACATGGTGGCGGG - Intergenic
1078780737 11:14436897-14436919 AATTAGCCACACATGGTGGCAGG - Intergenic
1079482947 11:20901786-20901808 AAGTTTCCACACATGACGAAAGG - Intronic
1080209967 11:29774334-29774356 TTTTATCCACACATGTAGACTGG - Intergenic
1081325268 11:41737005-41737027 CAGTTTCCACACATGGTGAGAGG - Intergenic
1084077244 11:66789436-66789458 AATTATTCAAACATGGAGAAAGG - Intronic
1085643501 11:78208113-78208135 CAGCAGCCACAAATGGAGACAGG - Intronic
1085818207 11:79763924-79763946 ATGTGTCCATACAGGGAGACTGG + Intergenic
1086255795 11:84874870-84874892 AACTAGCCACACATGGTGTCAGG + Intronic
1086688652 11:89762980-89763002 AATTATCCAGACATGGTGATGGG - Intergenic
1086717206 11:90076981-90077003 AATTATCCAGACATGGTGATGGG + Intergenic
1087133193 11:94687051-94687073 AATTAGCCAGACATGGAGGCGGG + Intergenic
1089380776 11:118029787-118029809 AAGTATCAAAACATAGAGCCTGG - Intergenic
1089706151 11:120279455-120279477 AAGTAACCACACAGGGAGAAGGG - Intronic
1090077644 11:123589590-123589612 AATTAGCCACACATGGTGGCAGG - Intronic
1091214073 11:133889454-133889476 AAGGACCAACACATGGAGACGGG + Intergenic
1091422887 12:358821-358843 AATTAGCCACACATGGTGGCAGG + Intronic
1091970720 12:4784635-4784657 AAGAATCAACACACGGAGAGAGG - Intronic
1092737207 12:11593766-11593788 AAGTAGCCAGACATGGTGGCGGG + Intergenic
1093443911 12:19232148-19232170 AAGTATGTACTCATGGAGACTGG - Intronic
1096620879 12:52864564-52864586 AATTAGCCAGACATGGTGACGGG + Intergenic
1097214766 12:57402144-57402166 AATTAGCCAGACATGGTGACAGG + Intronic
1098378277 12:69841085-69841107 AACTATCTGCACAAGGAGACTGG + Intronic
1098912037 12:76218796-76218818 AATTAACCAGACATGGTGACGGG + Intergenic
1099177824 12:79442137-79442159 AAGTTTCAACACATGAACACAGG + Intronic
1099615781 12:84933617-84933639 AATTATCCACTCATGGTGGCGGG - Intergenic
1099977494 12:89561222-89561244 ATGTATCCACTCCTGGAGAAAGG - Intergenic
1100955828 12:99907034-99907056 AAGTATCCAGGCAAGGACACAGG + Intronic
1101951494 12:109179633-109179655 AATTAGCCAGACATGGTGACAGG - Intronic
1103287144 12:119812092-119812114 AAGTATCCAGGCATGGTGGCAGG - Intronic
1104450329 12:128863795-128863817 AAGTAGCCACACGTGGTGGCGGG + Intronic
1105372388 13:19813379-19813401 AATTATCCAGGCATGGTGACAGG - Intergenic
1105376547 13:19850448-19850470 AATTAGCCAGGCATGGAGACGGG + Intronic
1106038111 13:26063972-26063994 AAGCAACAACGCATGGAGACAGG + Intergenic
1106164049 13:27226374-27226396 AAGTAGCCACACATGGTGGCAGG - Intergenic
1106557872 13:30825725-30825747 AATTAGCCAGGCATGGAGACAGG + Intergenic
1107378491 13:39830655-39830677 AAATATCCAGACACAGAGACTGG + Intergenic
1107410232 13:40151497-40151519 AATGGTCCACAGATGGAGACAGG - Intergenic
1108214313 13:48169086-48169108 AAGAATGGAGACATGGAGACTGG + Intergenic
1109239022 13:59860587-59860609 AATTATCCAGGCATGGAGGCGGG + Intronic
1109818118 13:67614367-67614389 AAGTATCCAGGCATGAAGGCGGG - Intergenic
1110754515 13:79156602-79156624 AAGTATCTTCACATGGAAAATGG + Intergenic
1113819435 13:113202470-113202492 AAATATCCATCCATAGAGACAGG + Intronic
1114138127 14:19876822-19876844 AAGTATCCACACAAGCCAACTGG - Exonic
1115490493 14:33953326-33953348 AATTAGCCACACATGGTGGCAGG + Intronic
1115529398 14:34313142-34313164 AAGTGTCCACACATAGAGAATGG + Intronic
1118646525 14:67846266-67846288 ACGAACACACACATGGAGACTGG - Intronic
1120565931 14:86056930-86056952 AAGTGAGAACACATGGAGACAGG - Intergenic
1121496962 14:94399145-94399167 AAGGATCCACACAGGGATGCTGG - Intergenic
1122296784 14:100710291-100710313 AATTATCCACACATGGTGGCCGG - Intergenic
1122576084 14:102743232-102743254 AATTAGCCAGACATGGTGACGGG - Intergenic
1126463936 15:48943491-48943513 AAGTATCCACTGATGGATAAAGG - Intronic
1127342728 15:58065180-58065202 TAGTATCCTCAGATGGAGGCCGG - Intronic
1127433890 15:58937506-58937528 AAGTAGCCAAGCATGGTGACAGG + Intronic
1129195848 15:73965757-73965779 AATTAGCCAGACATGGCGACAGG + Intergenic
1129774032 15:78222512-78222534 AATTAGCCAGACATGGTGACAGG + Intronic
1130157246 15:81362195-81362217 AAGTATTTACACCTGGAGAGTGG - Intronic
1130359171 15:83165644-83165666 AAGTAGCCAGACATGGTGATGGG + Intronic
1132195629 15:99912698-99912720 AAGTAGCCAGACATGGTGGCTGG - Intergenic
1132459301 16:42618-42640 AAGTGTCCATACAGGGAAACTGG - Intergenic
1132825549 16:1903556-1903578 AATTATCCAGACATGGTGGCGGG + Intergenic
1133461838 16:5993184-5993206 AAGTAGCAACACATGGATGCAGG + Intergenic
1136069745 16:27780772-27780794 CAGGATCCACACATGGTGAAGGG - Intergenic
1136255028 16:29032855-29032877 AAGTAGCCAGACGTGGTGACGGG + Intergenic
1136688313 16:32009146-32009168 AACCATCCACACAGGGAGGCGGG - Intergenic
1136788914 16:32952701-32952723 AACCATCCACACAGGGAGGCAGG - Intergenic
1136880898 16:33901233-33901255 AACCATCCACACAGGGAGGCAGG + Intergenic
1139278725 16:65751320-65751342 AAGCAGACACACATGGAGACAGG + Intergenic
1140552628 16:75883417-75883439 AAGTATGCACACACGGTGGCTGG + Intergenic
1140843784 16:78867062-78867084 AAGTATTCACAATTGGAGAAGGG + Intronic
1141310124 16:82905850-82905872 TAGTAACCACACATGGCTACTGG + Intronic
1203091111 16_KI270728v1_random:1214190-1214212 AACCATCCACACAGGGAGGCGGG - Intergenic
1142680709 17:1546608-1546630 CTGTACCCACACATGGAGGCTGG + Intronic
1143456844 17:7073571-7073593 AAGTAGCCAGACATGGTGGCAGG + Intergenic
1145688828 17:26710664-26710686 AAGTATCTTCACATAGAAACTGG + Intergenic
1147230085 17:39011356-39011378 AATTAGCCAGACATGGTGACAGG - Intergenic
1150772993 17:68057247-68057269 AAGTAGCCAGACATGGTGGCAGG + Intergenic
1151417371 17:73975181-73975203 AATTAGCCACACATGGTGGCAGG - Intergenic
1152157373 17:78643733-78643755 AAGGATCCAGACATTCAGACTGG + Intergenic
1152536137 17:80951223-80951245 AAGCATCCACACATCCACACCGG + Intronic
1155557931 18:27042398-27042420 GAGTATTTACACATGGAGATTGG - Intronic
1158466074 18:57691024-57691046 AAGTAGCCAGACATGGTGATGGG + Intronic
1159986974 18:74854129-74854151 CAGTATCCACCCCTGGGGACAGG + Intronic
1160193078 18:76731361-76731383 AAGTATCCCCACATGGTCACAGG + Intergenic
1160625105 18:80198735-80198757 AAGTATTCACATATGGAGAATGG + Intronic
1161225600 19:3143795-3143817 GAGTTTCCCCACATGGAAACAGG + Intronic
1162183417 19:8886378-8886400 AAGTCCACACTCATGGAGACTGG + Intronic
1162684695 19:12372308-12372330 AATTATCCAGACATGGTGGCGGG + Intergenic
1162984460 19:14260665-14260687 AAGTATCCAGGCATGGTGGCAGG - Intergenic
1163244700 19:16086199-16086221 AATTAGCCAGACATGGTGACGGG + Intronic
1165082539 19:33317303-33317325 AATTATCCAGACATGGTGGCGGG - Intergenic
1166421830 19:42642215-42642237 AGGTTTCCAAACATGGATACTGG + Intronic
1166712350 19:44945491-44945513 AAGGATCCAGACAGGGACACAGG - Exonic
1167525315 19:49979899-49979921 AATTAGCCACACATGGTGGCGGG + Intronic
925649121 2:6070062-6070084 ACGTATACACACAGAGAGACAGG - Intergenic
926168014 2:10533718-10533740 AAGTACCCACTTTTGGAGACAGG - Intergenic
926405618 2:12549442-12549464 AAGGCTCCAGACATGGAGCCAGG + Intergenic
926550263 2:14293154-14293176 AAATATCAAGACATGGTGACAGG - Intergenic
928742941 2:34376989-34377011 AGGTATCCTCACATGGTGAAAGG - Intergenic
928954689 2:36851974-36851996 AATTATACACACAATGAGACAGG + Intronic
929791623 2:45027501-45027523 AAGTGTACACACATGCAGTCAGG + Intergenic
931569368 2:63652120-63652142 ATGGTTCCACACATGGACACTGG + Intronic
932971513 2:76548926-76548948 AAATGTCCACAGTTGGAGACAGG + Intergenic
933187755 2:79297618-79297640 AAGTATACAACCATGCAGACTGG + Intronic
935877902 2:107531839-107531861 CAGTAGCCACACAGGGAGAATGG - Intergenic
936632414 2:114217928-114217950 GAGTATCCACACATGAATACCGG + Intergenic
937097700 2:119246589-119246611 AAGTTCTCACACATGGAGTCTGG - Intronic
937933527 2:127223751-127223773 ATTTAAACACACATGGAGACAGG + Intergenic
939763174 2:146210427-146210449 AAGTATCTACACCTGGACAATGG + Intergenic
941092737 2:161197023-161197045 ACGTATACACACATGTATACAGG + Intronic
941462615 2:165789269-165789291 AGGTATCCTCACATGGAGGAAGG + Intronic
946380951 2:219348606-219348628 AAGCATCCACACAGGCAGAAAGG + Intergenic
946942473 2:224784114-224784136 AAGTCTCCAGAGATGGAGAAAGG - Intronic
948407508 2:237733358-237733380 AGATGTCCACACATGAAGACAGG - Intronic
1168952409 20:1811398-1811420 AAGTGTCCCCAGATGCAGACAGG - Intergenic
1169507449 20:6227176-6227198 AAGACACCACACATGGAGACTGG - Intergenic
1169673335 20:8128956-8128978 AAATCTCCACACTTGGACACAGG + Intergenic
1169907854 20:10621449-10621471 ATCTATCCATACATAGAGACAGG - Intronic
1170982872 20:21231180-21231202 AATTAGCCAGACATGGTGACAGG + Intronic
1173099358 20:40070614-40070636 AATTAGCCAGACATGGTGACAGG + Intergenic
1175193120 20:57224590-57224612 AAGTCTGCACCAATGGAGACAGG + Intronic
1175412948 20:58783518-58783540 AAGTTTCCACACAGGAAGCCGGG + Intergenic
1175444718 20:59012152-59012174 AAGTAGCCACGCATGGTGGCAGG - Intergenic
1175636494 20:60588699-60588721 AAGTCACCAAACATGGAGAATGG - Intergenic
1178071735 21:28976161-28976183 AAGTATATATACATGTAGACAGG + Intronic
1178924451 21:36763171-36763193 AAGTAGCCAGACATGGTGATGGG - Intronic
1181301191 22:21882530-21882552 AATTAGCCAGACATGGTGACAGG - Intergenic
1181628809 22:24139686-24139708 ATGTGTCCACCCAAGGAGACTGG - Intronic
1182746159 22:32607054-32607076 AAGCATGCAGACATGGACACAGG - Intronic
1183705582 22:39473340-39473362 AAGTATCCACACATGGAGACGGG + Intronic
1184339343 22:43877565-43877587 AATTATCCAGGCATGGTGACGGG - Intergenic
1184461895 22:44642691-44642713 AAGTAGCCAGACATGGTGGCAGG + Intergenic
1184597331 22:45522132-45522154 AATTAGCCACGCATGGTGACAGG - Intronic
949418784 3:3842255-3842277 AAGTAACCAGACTTGGAGATGGG + Intronic
950767931 3:15287537-15287559 CAGTAGCCACACGTGGAGGCTGG - Intronic
950929708 3:16776218-16776240 AATTAACAACACATGGACACAGG + Intergenic
953250479 3:41242151-41242173 AAATATCCACAGATGGAGCAAGG + Intronic
955917919 3:63925236-63925258 AAGTATCCAGTCAAGGATACAGG + Intronic
956927476 3:74004721-74004743 AATTATCCACACATGAGAACAGG - Intergenic
957369037 3:79267063-79267085 AAATATCCACATATGGATAGTGG - Intronic
958450643 3:94268324-94268346 AATTAGCCAGGCATGGAGACAGG + Intergenic
964740193 3:159956920-159956942 AACTGGCCAGACATGGAGACTGG - Intergenic
966859555 3:184222284-184222306 AAGTAGCCAGGCATGGTGACAGG + Intronic
967826348 3:193880659-193880681 AAGTAGCCAGACATGGTGGCAGG + Intergenic
968001031 3:195206944-195206966 AAATATCCACAGAAGGAGAGAGG - Intronic
968963738 4:3759001-3759023 AAGGACCCACAGATGGAGACAGG + Intergenic
969450464 4:7270026-7270048 AATTAGCCACACATGGTGGCAGG - Intronic
970642508 4:18082770-18082792 AAATCTCAACAGATGGAGACAGG - Intergenic
972155862 4:36160993-36161015 AAGGAGCCAAAAATGGAGACAGG + Intronic
972167606 4:36306792-36306814 GAGTAGCCACTCATAGAGACAGG + Intronic
972228900 4:37047587-37047609 AAGTTTCCACACATGAACATTGG - Intergenic
973750344 4:54011729-54011751 CAGAAGCCACACATAGAGACTGG + Intronic
973816216 4:54621798-54621820 AATTAGCCAGACATGGAGGCAGG + Intergenic
973986469 4:56359406-56359428 AATTAGCCACACATGGTGGCAGG - Intronic
975467893 4:74730742-74730764 AAGTATAGTTACATGGAGACAGG - Intergenic
976187182 4:82453522-82453544 TAGTTTGCACTCATGGAGACAGG - Intronic
978239793 4:106501891-106501913 AAGTCTCCCCAGATGGAAACAGG + Intergenic
978324314 4:107534756-107534778 AAATATCCATCCATGGAGGCTGG + Intergenic
978771770 4:112464730-112464752 CAGTAGCCACACATGGAAACAGG + Intergenic
978914457 4:114106761-114106783 TAGTACCCACATATGGAAACAGG - Intergenic
981664104 4:147202110-147202132 AATTAGCCAGACATGGTGACAGG - Intergenic
982175617 4:152702960-152702982 AATTAGCCACACATGGTGAGTGG + Intronic
983421283 4:167520591-167520613 AAGTGTACAGACATGGAGGCAGG - Intergenic
983775785 4:171605445-171605467 AATTATCTACACATTGGGACAGG + Intergenic
987067071 5:14300319-14300341 CAATAGCCACACATGGTGACAGG - Intronic
991234333 5:64376575-64376597 AAGAATCAAGACATGGAAACAGG + Intergenic
991475882 5:67018999-67019021 ATGTGTGCACACATGCAGACAGG - Intronic
992231892 5:74671920-74671942 TATTCTCCTCACATGGAGACCGG + Intronic
993492762 5:88571891-88571913 AATTATCCTGAGATGGAGACAGG - Intergenic
993936640 5:94012823-94012845 AAATCTCCTCACAAGGAGACAGG + Intronic
996237776 5:121153713-121153735 AAGTAGCCAGGCATGGAGGCGGG + Intergenic
998634846 5:143942068-143942090 TAGTCTCCACTCATGGACACAGG + Intergenic
1000733429 5:164866482-164866504 CAGTAACCACACATGGATAGTGG + Intergenic
1003095338 6:3138668-3138690 CAGCATCCACCCATGGAGACAGG + Intronic
1003507950 6:6755213-6755235 AATTAGCCAGACATGGTGACAGG - Intergenic
1004486550 6:16071969-16071991 AAATATCTACACGGGGAGACTGG - Intergenic
1005064273 6:21803384-21803406 AATTAGCCACACATGGTGGCAGG - Intergenic
1005382814 6:25254575-25254597 AAGTAGCCAGACATGGTGGCAGG + Intergenic
1006711518 6:36076652-36076674 GAGTATACACCCATGGACACTGG - Intronic
1008271891 6:49499879-49499901 AAGTGCCCACACCTGTAGACGGG - Intergenic
1012645487 6:101673762-101673784 AAGTAACTACAAATGAAGACTGG - Intronic
1012648890 6:101726568-101726590 GAGTACCTACACATGAAGACAGG + Intronic
1013988892 6:116229989-116230011 AAGAATACACACAAGGTGACCGG - Intronic
1017718306 6:157227515-157227537 GCACATCCACACATGGAGACTGG + Intergenic
1018951705 6:168382566-168382588 AATTTTACAGACATGGAGACAGG + Intergenic
1018973337 6:168544725-168544747 CAGTTTCCACACATGCAGAAGGG - Intronic
1019180261 6:170182444-170182466 AAGAATCCACACCTGCAGGCAGG + Intergenic
1022766147 7:33414501-33414523 ATGTATACACACAAAGAGACAGG - Intronic
1023154875 7:37239311-37239333 AATTATCCATGCATGGTGACAGG - Intronic
1023338587 7:39195617-39195639 AAGTGGCCCCACATGGATACTGG - Intronic
1023371862 7:39519740-39519762 AGGTATCCAGGAATGGAGACTGG - Intergenic
1023867764 7:44246595-44246617 ATGTATACACACATGCACACAGG + Intronic
1024285417 7:47753101-47753123 AATTAGCCACGCATGGTGACGGG - Intronic
1024589430 7:50868266-50868288 TAGCATCCACTCATGGAGAGTGG - Intergenic
1026436063 7:70400103-70400125 AAGGATCCACACTTGGTCACAGG - Intronic
1027340041 7:77197375-77197397 AAATATCCTCACATGCAGACTGG - Intronic
1027403808 7:77836765-77836787 CAGTAAGAACACATGGAGACAGG + Intronic
1029321357 7:99763455-99763477 CTGTATCCACATATGGACACAGG - Intronic
1029789800 7:102830315-102830337 AAGCAGGCACAGATGGAGACTGG - Intronic
1029837037 7:103323076-103323098 AAGTAGCCAGGCATGGTGACAGG - Intronic
1031223287 7:119000874-119000896 AAGTATCTACATATGAGGACAGG - Intergenic
1032169420 7:129572179-129572201 ATCTATGCACACCTGGAGACTGG + Intergenic
1032434899 7:131892383-131892405 AAAGATCCACACATGGATATAGG + Intergenic
1034130696 7:148714013-148714035 AAATATACACACATGCAGCCAGG - Intronic
1036117221 8:5971528-5971550 AAGTATCCAGACATGGTGGCAGG + Intergenic
1037896016 8:22656414-22656436 AAGTATGTAGACATGGTGACTGG - Intronic
1038062132 8:23925397-23925419 AAATAGCCAGGCATGGAGACGGG - Intergenic
1038079531 8:24118138-24118160 AAGTAGCCAGGCATGGTGACGGG - Intergenic
1039730086 8:40265558-40265580 CAGTATGCACATATGGAGGCTGG + Intergenic
1039757758 8:40541453-40541475 AAATAGCCACACATGGCTACTGG - Intronic
1039837201 8:41266015-41266037 AATTAGCCACACATGGTGGCAGG + Intronic
1043815504 8:84796013-84796035 AAGTAGCCACAGCTGGAGAAGGG + Intronic
1043945250 8:86243785-86243807 AATTAGCCAGACATGGTGACAGG + Intronic
1045153045 8:99430865-99430887 AAGTAGCCAGACATGGTGGCAGG - Intronic
1045961320 8:107972292-107972314 AATTATCCAGACATGGTGGCAGG - Intronic
1047326717 8:123845847-123845869 AACTAGCCAGACATGGTGACAGG - Intergenic
1048422007 8:134286044-134286066 AAGTATCCAGAGTAGGAGACAGG - Intergenic
1048600052 8:135910204-135910226 AAGGATCCAGAAATGAAGACAGG - Intergenic
1048777182 8:137960083-137960105 AAGCATACACACTTGGAGCCAGG + Intergenic
1049143870 8:140983236-140983258 AATTAGCCACACATGGTGACAGG + Intronic
1050532529 9:6603077-6603099 AATTAGCCAGACATGGTGACAGG + Intronic
1050712686 9:8483601-8483623 AATTAGCCAGACATGGCGACAGG + Intronic
1052667437 9:31513269-31513291 CAGTATGAACACATGGATACAGG - Intergenic
1052771337 9:32693738-32693760 AAATAAGCACACATGGAGAATGG - Intergenic
1055044074 9:71907393-71907415 AAGTATCAACACGTGGATATAGG + Intronic
1058326951 9:103710473-103710495 TAGTTTACACACATGGACACAGG + Intergenic
1060533650 9:124365294-124365316 AAGGAGCCACAGATGGACACGGG + Intronic
1062555921 9:137113440-137113462 AAGTATCCCCACCTGGTGGCGGG - Exonic
1203379618 Un_KI270435v1:20287-20309 AAGTATCTTCACATGAAAACTGG + Intergenic
1187174514 X:16883971-16883993 AAATAGCCACACATGGCTACTGG + Intergenic
1190942876 X:55059990-55060012 GAGTATACACACACAGAGACGGG - Intergenic
1191956041 X:66643241-66643263 GAGTAAACACAGATGGAGACAGG - Intergenic
1192124327 X:68487788-68487810 GAGAATCCACACATGGACAGAGG + Intergenic
1194048438 X:89037185-89037207 AATAATCCACACAGGGAGAGAGG + Intergenic
1194927242 X:99839982-99840004 AGGTATCCTCACATGGAGGAAGG - Intergenic
1196612195 X:117727909-117727931 GAGGATCTACTCATGGAGACTGG - Intergenic
1197437379 X:126448043-126448065 AATTATCCAAACCTGGAGAAAGG - Intergenic
1198824397 X:140683955-140683977 AACTAGCCAGACATGGTGACAGG + Intergenic
1199119477 X:144034526-144034548 AATTATCAACAGATGAAGACTGG + Intergenic
1199159222 X:144587602-144587624 AAGAATCCACACAGGGAGCAGGG + Intergenic
1199997391 X:153034131-153034153 GAGAATTCCCACATGGAGACAGG - Intergenic