ID: 1183705788

View in Genome Browser
Species Human (GRCh38)
Location 22:39474234-39474256
Sequence TGGGCAGATGCAGCTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 3, 3: 24, 4: 258}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183705775_1183705788 30 Left 1183705775 22:39474181-39474203 CCGGGGTGCTCACATGGTTTCAG 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1183705788 22:39474234-39474256 TGGGCAGATGCAGCTTTCCTGGG 0: 1
1: 0
2: 3
3: 24
4: 258

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183705788 Original CRISPR TGGGCAGATGCAGCTTTCCT GGG Intronic
900583522 1:3421222-3421244 TGGGCAGCGGCATCCTTCCTAGG - Intronic
900615048 1:3561672-3561694 CTGGAAGAGGCAGCTTTCCTAGG - Intronic
902675399 1:18005210-18005232 GGGGCAGAGGCAGCTTCCCTGGG + Intergenic
903227403 1:21901696-21901718 TGGGCAGCTGCAGCCGCCCTGGG - Intronic
904224970 1:29009479-29009501 TTGGCAGCTTCAGCTTACCTAGG + Intronic
906399623 1:45495505-45495527 TGGGCAGAGGCAGCTTAGATTGG + Intronic
906426502 1:45718460-45718482 TGGGCAGATGCATCAGTTCTTGG - Intronic
906706612 1:47899712-47899734 TGGGTAGATACAGCATTCCAAGG + Intronic
908423389 1:63981386-63981408 TGGGAAGCTTCAGCCTTCCTGGG - Intronic
909890364 1:80997963-80997985 GGGGCAGATCCAGGTTTCCTGGG - Intergenic
911056427 1:93712257-93712279 GGGACAGATGTGGCTTTCCTGGG - Intronic
912093658 1:106113752-106113774 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
915444923 1:155969157-155969179 TGGGCAGATGAGGGCTTCCTTGG + Exonic
915637325 1:157195814-157195836 TGGGCTGCTGCAGCTGGCCTGGG - Intergenic
915781993 1:158562666-158562688 TGGGCAGATGTCACTATCCTAGG - Exonic
916704194 1:167330353-167330375 TGGGCAGATACTGCTACCCTGGG - Intronic
917854096 1:179087727-179087749 TGGTCAGATGCAAATGTCCTAGG + Intronic
919453889 1:197801014-197801036 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
919851728 1:201677432-201677454 TGGGCAGAGGCTGCTGGCCTTGG - Intronic
921116150 1:212093476-212093498 TGAGCAGAAGTAGCTTTCCGCGG + Intronic
922463294 1:225829064-225829086 TGGGCAGGTGCAGGTTGCTTTGG + Intronic
923040127 1:230313967-230313989 CGGGCAGTTGCAGCTCTCCTGGG + Intergenic
923145064 1:231191982-231192004 GGAGCTGATGCAGCTTTCCTGGG + Intronic
923605293 1:235437872-235437894 GGGTGAGATGTAGCTTTCCTTGG + Intronic
924195660 1:241604429-241604451 TGGGCAGGAGCACCTCTCCTGGG - Exonic
1062770139 10:92548-92570 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1064946391 10:20794698-20794720 TGTGCAGATTCAGTATTCCTGGG - Intronic
1065806018 10:29394479-29394501 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
1066101629 10:32122968-32122990 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1066143831 10:32535801-32535823 TTTGCAGATGCAGATTTCCCTGG + Intronic
1067730207 10:48805267-48805289 TGGGCAGCTTCAGCATTCCTGGG - Exonic
1068778542 10:60894261-60894283 TGGTCTGGTGCAGCTTTTCTTGG - Intronic
1069561888 10:69436324-69436346 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1070166755 10:73904680-73904702 TGGACAGCTGGAGCTATCCTGGG + Intergenic
1072753184 10:97999141-97999163 TGGGCAGCTGCAGCTGTGCCTGG - Intronic
1073427625 10:103465414-103465436 TGGGCACCTCCAGGTTTCCTTGG - Intergenic
1073488542 10:103837511-103837533 TGGGCAGAGCAAGCTTCCCTGGG + Intronic
1074365032 10:112850872-112850894 GGGGCAGATCCAGGTTTCGTAGG - Intergenic
1074630576 10:115250571-115250593 TGGGCTGAAGCAGCATTCCTAGG + Intronic
1074702060 10:116101130-116101152 TGTGCAGAAGGAGCTGTCCTGGG - Intronic
1074974799 10:118571350-118571372 TTCTCAGATGCATCTTTCCTGGG + Intergenic
1075531148 10:123230881-123230903 TGGGCAAATGCAGTTTATCTGGG + Intergenic
1075541478 10:123317858-123317880 TGGGCACAGGCAGCACTCCTGGG + Intergenic
1075586332 10:123660924-123660946 TGTGCATAAACAGCTTTCCTGGG + Intergenic
1076164651 10:128271978-128272000 TGGGCAGATGGGGCTTGCCAGGG - Intergenic
1078472584 11:11603541-11603563 TAGGCAGATGCATATTTCCAGGG - Intronic
1079296600 11:19240880-19240902 TGGGCAAATACAGCCTTCCAAGG - Intronic
1079961686 11:26932075-26932097 TGGACAGCTGCAGCTTTCAGAGG + Intergenic
1081628717 11:44672445-44672467 GGGGCAGATGCCACTTTGCTTGG + Intergenic
1081649734 11:44815758-44815780 TGGGCAGGGGCAGCTTCTCTTGG + Intronic
1084700483 11:70783643-70783665 TGGGCAGAGACAGTTATCCTGGG + Intronic
1088502547 11:110497185-110497207 TGGGAGGATGAAGCTTCCCTAGG + Intergenic
1089628846 11:119770791-119770813 TGGGAAAAGGCAGCTGTCCTGGG + Intergenic
1090411331 11:126511913-126511935 TGTGCAGCTGCAGCTCCCCTGGG + Intronic
1090646362 11:128769519-128769541 TGGTGAGATGCAGCTTCCCAGGG - Intronic
1091325067 11:134679848-134679870 TGGGCAGATGGGCCTTGCCTGGG + Intergenic
1093410972 12:18866181-18866203 TGGGTAGATGCAGGCTTCCCTGG - Intergenic
1095863607 12:46947481-46947503 TGAGCAGGTTCAGCTTTGCTTGG - Intergenic
1096476185 12:51910696-51910718 TGGGCAGATTCAGCTCCTCTAGG + Intronic
1096485874 12:51980823-51980845 TGGGCAGCAGCAGCTCTCCATGG + Intronic
1096783474 12:54004135-54004157 TGTGCAGCTGCAGCATTTCTGGG + Intronic
1097299104 12:57998616-57998638 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1100672931 12:96835782-96835804 TGGGCAGCTGCAGCTATCCCTGG + Intronic
1101168281 12:102061843-102061865 GGGGAAGACGCAGCTTTCCGGGG - Intronic
1102243062 12:111337568-111337590 TGGGCAAGTGCAGCTATCCCAGG + Intronic
1104742413 12:131188356-131188378 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
1105511380 13:21054519-21054541 TGGGGAGGTGCAGCTGCCCTAGG - Intronic
1107722868 13:43267341-43267363 TGCGAAGATGCAGCTTTTCTAGG - Intronic
1107841024 13:44458578-44458600 TGGGCAGCTGCAGCTGTGCCTGG - Intronic
1108046734 13:46390399-46390421 AAGCCAAATGCAGCTTTCCTCGG - Intronic
1108486666 13:50933985-50934007 TCTGCAAATGCAGCTTTCTTGGG - Intronic
1109348368 13:61145079-61145101 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
1110834560 13:80068580-80068602 TGGGCTGATCCAGGTTTCATGGG + Intergenic
1110834563 13:80068599-80068621 TGGGCAGATCCAGATTTTATGGG + Intergenic
1111119143 13:83823572-83823594 TGGGCAGCTGCAGCTGTGCTGGG - Intergenic
1111485608 13:88895444-88895466 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
1112392940 13:99001892-99001914 AGGACAGATCCAGCTTTCATAGG - Intronic
1114627428 14:24138587-24138609 TGGGCAGAGGCAGCTTTCCCAGG + Exonic
1115443737 14:33465616-33465638 TGGTCACATGTAGCTTTTCTAGG - Intronic
1115487469 14:33925904-33925926 AGGGCAGATTCAGTTTTCCCTGG + Exonic
1116356651 14:43938788-43938810 TGGGCAGCTGCAGCTGTGCCGGG - Intergenic
1117090990 14:52250078-52250100 TGGGAAGATGCAGCTCACCATGG + Intergenic
1118318576 14:64740411-64740433 TGGGCATATGCAGTTGTGCTGGG + Intronic
1118423980 14:65637881-65637903 TGGGCAGATGCAACACCCCTAGG - Intronic
1118511648 14:66481131-66481153 TGAGGAGATGCAGCTTTTCCAGG + Intergenic
1118766027 14:68909821-68909843 GGGGAAGAAGTAGCTTTCCTTGG - Intronic
1118984011 14:70738255-70738277 TGGTCAGAAGGAGCTTGCCTCGG - Exonic
1122886586 14:104713068-104713090 TGGGCAGAGGCACCTTTCGTCGG + Intronic
1122967107 14:105136519-105136541 TGTGCAGCTGCAGCCCTCCTAGG + Intergenic
1125503758 15:40254938-40254960 TGGGCTGAACCTGCTTTCCTGGG - Intronic
1125594906 15:40878587-40878609 TGGGCTGGGGCAGCTTCCCTGGG - Intergenic
1125775386 15:42208102-42208124 TTTGCAGAGGCAGCTTTTCTAGG + Exonic
1125861984 15:43008263-43008285 TGGGCAGTTGCAGCTGTGCCCGG - Intronic
1126226778 15:46280099-46280121 AGGGCAGATGCAGCTTAGATTGG - Intergenic
1127310004 15:57744104-57744126 TAGGGAGATGGAGCTTCCCTAGG - Intronic
1127500411 15:59549347-59549369 GGGGCAGTTGGCGCTTTCCTAGG + Intergenic
1129228705 15:74184647-74184669 CGGGCAGGTGCAGCTTCCCCAGG + Intronic
1131097821 15:89667069-89667091 TGGGCACCTGCAGCTGTGCTGGG - Exonic
1132362342 15:101227024-101227046 TGGGCAGAGGCAGCCTTTCCAGG + Intronic
1132473244 16:118792-118814 TGGGCAGATGTGGCTCTCCCTGG - Intronic
1132473260 16:118851-118873 TGGGCAGATGCGTCTGTCCTTGG - Intronic
1132473285 16:118930-118952 TGGGCAGATGTGGCTTCCCCTGG - Intronic
1132473305 16:118990-119012 TGGGCAGGTGTGGCTCTCCTTGG - Intronic
1132473317 16:119030-119052 TGGGCAGGTGTGGCTCTCCTTGG - Intronic
1132473322 16:119050-119072 TGGGCAGGTGTGGCTCTCCTTGG - Intronic
1132473327 16:119070-119092 TGGGCAGATGTGGCTCTCCTTGG - Intronic
1135402347 16:22174744-22174766 TGAGCATCTGCAGCTTTCCATGG + Intronic
1137485506 16:48887292-48887314 TGGGCAGATGTTGGTGTCCTAGG + Intergenic
1138240786 16:55425420-55425442 TGGGAAGCTGCACCTTTGCTGGG + Intronic
1138639149 16:58369016-58369038 TGGGAAGAGTCACCTTTCCTGGG - Intronic
1139150863 16:64380953-64380975 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
1140037880 16:71384911-71384933 TGGGAAGAGACAGCTTTCCAGGG + Intronic
1140734228 16:77883833-77883855 ACTGCAGAAGCAGCTTTCCTGGG - Intronic
1141385037 16:83614303-83614325 TCCTCGGATGCAGCTTTCCTGGG + Intronic
1141395928 16:83704589-83704611 TGGGGAGACACAGCTTTCCCTGG - Intronic
1141862974 16:86730524-86730546 GGGGCAGGTACAGCTGTCCTAGG + Intergenic
1141863804 16:86736024-86736046 TGGGAAGGAGCAGCTTTCCAAGG - Intergenic
1142367964 16:89660269-89660291 TGGGCAGGCGAAGCCTTCCTGGG - Intronic
1143957482 17:10683758-10683780 TGTGCAGATCCAGCTTTCTATGG + Intronic
1145217213 17:21061339-21061361 TGGGCTGCTGCAGCTGTGCTTGG + Intergenic
1146086832 17:29837998-29838020 TGGGCAGCTGCAGCTATGCCTGG - Intronic
1147624605 17:41892022-41892044 TGGGCAGAGGCTGCTTATCTGGG - Intronic
1147702055 17:42402520-42402542 TGGGCAGATGCAGTTTTCTGTGG - Exonic
1148445505 17:47734699-47734721 TGGGCAGATGAAGCTCACCCAGG + Intronic
1149895577 17:60426193-60426215 TGGGCAGGTGCAACTTTCGCAGG - Exonic
1150001694 17:61444364-61444386 TGGGGGGATGCAGCTGTCCAAGG - Intergenic
1151703762 17:75756424-75756446 TGAGCCGATGCAGCTCACCTGGG - Exonic
1152721509 17:81926135-81926157 TGGCCAGAGCCACCTTTCCTTGG - Intronic
1153608052 18:6854733-6854755 TGGGCAGCTGCAGCTGTGCCTGG - Intronic
1154358579 18:13641532-13641554 TGGGCAGAGGCCGCTGCCCTAGG - Intronic
1154390296 18:13931161-13931183 AGGACAGCTGCAGCTTCCCTGGG + Intergenic
1155067471 18:22280124-22280146 TGTGCAGCTGCAGCTTTTCCTGG - Intergenic
1156244573 18:35284958-35284980 TGGGCAGCTGCAGCTATGCCTGG + Intronic
1161700730 19:5793607-5793629 TGAGTAGATCCAGCTTTCCTTGG - Intergenic
1162193701 19:8967116-8967138 TGGGCTGATGCTGGGTTCCTTGG + Exonic
1162375856 19:10305012-10305034 TGGGCAGAAGCAGCTCTCCTAGG - Exonic
1164841608 19:31397336-31397358 TGGGCAGCTGCCTCTTCCCTAGG + Intergenic
1165417783 19:35705382-35705404 TGTGCACATGAAGGTTTCCTGGG + Intronic
925142432 2:1559325-1559347 TGGGGCGATTCAGCTTTCCCGGG - Intergenic
925358737 2:3262493-3262515 TGGGCTGGTCCAGCCTTCCTAGG - Intronic
925628131 2:5862514-5862536 TGAACAGATGCCGCATTCCTTGG + Intergenic
925845636 2:8030900-8030922 TGGCAAGATGCAGCTCTGCTTGG - Intergenic
926586669 2:14693631-14693653 TCTGCAGATGCAGCTTTCTAAGG + Intergenic
928109042 2:28491747-28491769 TGGGCTGACTTAGCTTTCCTTGG - Intronic
931235282 2:60407519-60407541 AGGGCAGCTGCAGCTGCCCTTGG + Intergenic
933607279 2:84396501-84396523 TTGGCAGGTGCAACTCTCCTGGG + Intergenic
934677253 2:96258343-96258365 TGGGCTGAGTCAGCTTTGCTGGG - Intronic
937072072 2:119072186-119072208 CGGGCTGATGCAGCCTACCTTGG + Intergenic
937817677 2:126271285-126271307 GTGGCTGATGCTGCTTTCCTGGG + Intergenic
937925850 2:127166753-127166775 CAGGCAGAAGCAGCTTTTCTGGG + Intergenic
938195056 2:129319495-129319517 TGGGCAGCTGCAGCTGCCCGGGG + Intergenic
940266505 2:151844475-151844497 TAGGCAGTAGCTGCTTTCCTTGG - Intronic
940612309 2:156006861-156006883 TGGGCAGTTGCAGCTGTGCCTGG + Intergenic
941753037 2:169153454-169153476 TGGACACCTGCTGCTTTCCTAGG + Intronic
944502088 2:200372338-200372360 AGGGCAGGTGAAGCTGTCCTGGG - Intronic
945887109 2:215387348-215387370 TGGGCAGATCTTGCTTTACTTGG - Intronic
946187780 2:217990943-217990965 TTTGCAGGTGCAGCCTTCCTGGG + Intronic
946372716 2:219290450-219290472 TTGGCAGCTGCTGCTTTCCCTGG + Intronic
947585981 2:231357267-231357289 TGGGCAGCTGCTGCCTCCCTAGG - Intronic
948066648 2:235086238-235086260 TGGGCAGATGAAGTCTTCATTGG + Intergenic
1168983516 20:2027347-2027369 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1169354766 20:4897268-4897290 TGGGCAGGTGCAGGTGTGCTGGG - Intronic
1169474247 20:5916704-5916726 TGGGCTGATGCAGTATTCTTAGG - Intronic
1169570296 20:6898811-6898833 TGGGCAGGTGCTGCTTCCCAGGG + Intergenic
1172182368 20:33011221-33011243 TGGGCAGATGCTCCTATCCACGG + Intronic
1175770555 20:61620933-61620955 CGGGAAGGTTCAGCTTTCCTGGG + Intronic
1175944783 20:62553642-62553664 TGGGCATCTGCTGGTTTCCTGGG - Exonic
1176043600 20:63081117-63081139 ATGGCAGATTCAGCTTCCCTGGG + Intergenic
1177665274 21:24148622-24148644 AGCGCAAAAGCAGCTTTCCTGGG - Intergenic
1177989378 21:28019351-28019373 TGGGCAGTTGCAGCTGTGCCTGG + Intergenic
1182176181 22:28291612-28291634 GAAACAGATGCAGCTTTCCTGGG + Intronic
1182277908 22:29202035-29202057 TGGGCAGCTGCAGGCTGCCTAGG + Intergenic
1183316811 22:37141539-37141561 TGGGCAGCTGCAGCTGCCCCAGG - Intronic
1183705788 22:39474234-39474256 TGGGCAGATGCAGCTTTCCTGGG + Intronic
1184330054 22:43821590-43821612 TGGGAAGATGCAGCCTCCATGGG + Intergenic
1185117478 22:48945899-48945921 TGGGCAGGGCCAGCTATCCTGGG - Intergenic
949681936 3:6524046-6524068 TGGGCTGATGCAGCAGCCCTAGG - Intergenic
949695408 3:6688701-6688723 TGGGTAGAAGCATGTTTCCTTGG - Intergenic
950127208 3:10517272-10517294 TGGGCAGATGCATCTCGCCTCGG + Intronic
952734755 3:36677934-36677956 TGGGGGGATGCAACTTTTCTGGG - Intergenic
955952993 3:64260941-64260963 TGATCAGATGCAGCTGTCCTGGG - Intronic
957136383 3:76294254-76294276 TGGGCAGCTGCAGCTGCCCCTGG + Intronic
957614433 3:82509183-82509205 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
957727595 3:84087500-84087522 AGTCCAGATGCTGCTTTCCTGGG - Intergenic
960119736 3:113935335-113935357 TTGTCAGATGCAGCTTTCCTGGG + Intronic
962763937 3:138543555-138543577 TGGGCAGATGCAGCTGTGCCTGG + Intronic
964569170 3:158094318-158094340 AGGACAGAGGCCGCTTTCCTTGG - Intergenic
965087138 3:164113726-164113748 TGGGCAGCTGCAGCTGTTCAGGG - Intergenic
966254075 3:177898447-177898469 TGGGCAGCTGCAGCTATGCCTGG - Intergenic
967072949 3:185977577-185977599 TGGCCAGATGCACCCTTCCCCGG - Intergenic
967862747 3:194164517-194164539 TGGGCAGATTCACCTCTCCTAGG - Intergenic
968980888 4:3848822-3848844 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
969375971 4:6763432-6763454 TGGCCACATGCAGCTGGCCTGGG - Intergenic
969969254 4:11028818-11028840 TGGGCCAGAGCAGCTTTCCTGGG - Intergenic
970504557 4:16714370-16714392 TGGGCAGCCACAGCTTTCTTGGG + Intronic
973694508 4:53476833-53476855 TGGGCTGCTGCAGTCTTCCTGGG + Exonic
974179057 4:58360913-58360935 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
974316041 4:60282237-60282259 TGGTCAGGTGTGGCTTTCCTGGG + Intergenic
974440764 4:61914107-61914129 TGAGTAGATTCAGCTTTCTTTGG + Intronic
978301136 4:107270497-107270519 TGTGCAGATGCAGCCTTGCCTGG + Intronic
978663524 4:111155056-111155078 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
979638051 4:122978991-122979013 TGGGCAGCTGCAGCTGTGCCTGG + Intronic
979774970 4:124579013-124579035 TGGGCAAATCCAGTTTTTCTTGG - Intergenic
981078068 4:140610333-140610355 TGGGGAGATGCATTTTTCCATGG - Intergenic
982261031 4:153494632-153494654 TTGGCAGAAGGGGCTTTCCTCGG - Intronic
982545063 4:156724054-156724076 TGGGCAGCTGCAGCTGTGCCTGG - Intergenic
985584647 5:724001-724023 AGGGCAGATGCAGCTACCATAGG - Intronic
985598153 5:808331-808353 AGGGCAGATGCAGCTACCATAGG - Intronic
985651449 5:1109599-1109621 TGGGCAGACGCGGCCTTGCTGGG + Intronic
986759727 5:10868870-10868892 TGGCCCAATGGAGCTTTCCTGGG + Intergenic
988120027 5:26949438-26949460 TTTGTAGATGCAGCCTTCCTTGG - Intronic
988786938 5:34573715-34573737 TCAGGAGATGCAGCCTTCCTGGG - Intergenic
989730561 5:44642312-44642334 TGGGCAGCTGCAGCTGTGCTTGG + Intergenic
993102425 5:83557147-83557169 TGGCCAAATGCAGCTATTCTAGG - Intronic
993785885 5:92134980-92135002 TGAGCACATGCATGTTTCCTTGG + Intergenic
994667348 5:102721978-102722000 AGGGCACAGGAAGCTTTCCTAGG - Intergenic
995483292 5:112614231-112614253 TGGGCAGCTGCACCTGTCTTAGG - Intergenic
998534955 5:142921184-142921206 TGTGCAAATGCAGGTTACCTGGG - Intronic
998610991 5:143688056-143688078 TGGGCCAAAGCAGCTTTCCTGGG + Intergenic
998639833 5:143996985-143997007 TGGGCAGATTCAGCTTGTTTGGG + Intergenic
998822960 5:146073347-146073369 TGGGCACTTGCAGCTTCCCAAGG + Intronic
999111968 5:149129290-149129312 TAGGCACATTCTGCTTTCCTGGG - Intergenic
1000157273 5:158564069-158564091 GGGGCAGATGCAGCTCCTCTAGG - Intergenic
1001279069 5:170372974-170372996 GGGGGAGATGCAGCTGGCCTGGG + Intronic
1003499320 6:6691350-6691372 GGGGCTGAAGCAGCATTCCTAGG - Intergenic
1005594623 6:27367814-27367836 TGGGCAGCTGCAGCTGTTCCTGG - Intergenic
1005636937 6:27761810-27761832 AGAGGAGAAGCAGCTTTCCTTGG + Intergenic
1005790512 6:29295577-29295599 TGGACAGCTGCAGCTGTGCTTGG - Intergenic
1006517897 6:34554853-34554875 TGGGGAGATGCAGCTTTATTGGG + Intronic
1006708849 6:36047651-36047673 TGAGCAGCTTCAGCCTTCCTGGG + Intronic
1007979308 6:46134249-46134271 TGGGTAGATCCAACTTTTCTTGG - Intronic
1009644031 6:66373675-66373697 TGGGCAGATGGAGGTTTTCTTGG + Intergenic
1018689987 6:166337066-166337088 TGTGCAGAGGGAGCTTTCCCCGG - Intronic
1019371649 7:665113-665135 GGGGCAGTTGCAGCTCTCCGTGG - Intronic
1020330566 7:7012991-7013013 TGGGCATATGGAGCTTGCTTCGG + Intergenic
1022943785 7:35262256-35262278 CGGCCAGCTGCAGCTTTTCTGGG + Intergenic
1023352341 7:39333128-39333150 TGAGCAGGTGCAGCTCCCCTGGG + Intronic
1023852562 7:44158522-44158544 TGGGCAGATGCTGCAGGCCTGGG + Intronic
1025264068 7:57441012-57441034 TGGGCAGATGCACATGTCCCTGG - Intergenic
1026874307 7:73870835-73870857 TGGGGAGAGGCAGCTGACCTTGG + Intergenic
1029124479 7:98287142-98287164 TGGACAGATCCAGCTGTCCCAGG - Intronic
1030866954 7:114711573-114711595 TGGGCTGAATCAGCCTTCCTGGG + Intergenic
1031786460 7:126040440-126040462 TGGGCAGCTGCAGCTATGCGTGG - Intergenic
1032487164 7:132296707-132296729 TGAGGGGAAGCAGCTTTCCTTGG - Intronic
1033548227 7:142421663-142421685 TTGACTGAAGCAGCTTTCCTGGG + Intergenic
1033780228 7:144659813-144659835 TGGGCAGTTGGAGCTTTTCTGGG - Intronic
1034259545 7:149746211-149746233 TGGGAAGATGCATCTTTGCAAGG + Intergenic
1034555855 7:151849964-151849986 TGGGCAGGAGCAGCTTCCCCAGG - Intronic
1035013117 7:155738358-155738380 TGGGCAGAAACGGCTGTCCTGGG - Exonic
1035681081 8:1488553-1488575 TGGGCAGCTGCAGCCCACCTCGG - Intergenic
1036716289 8:11127194-11127216 TGGTCAGATTCAGCTGGCCTTGG + Intronic
1036768619 8:11564232-11564254 TGGGCAGAGGCAGCTTCGCAGGG + Exonic
1038553151 8:28487057-28487079 TGAGGAGAAGTAGCTTTCCTTGG + Intronic
1041073373 8:54146856-54146878 TGGGGTTATGCAGCATTCCTTGG + Intronic
1041990187 8:63978910-63978932 TGTACAGATGCGTCTTTCCTTGG + Intergenic
1043082672 8:75785138-75785160 TGGGCAGCTGCAGCTGTGCCTGG + Intergenic
1044540628 8:93404886-93404908 TGGGCAGCTGCAGCTTTAGGGGG + Intergenic
1045650586 8:104338615-104338637 AGGGCAGTTGCAACTTTCTTGGG - Intronic
1047494059 8:125397120-125397142 TGGAGAGATGCAGGTTTCCAGGG - Intergenic
1048194111 8:132318000-132318022 TGGGTGGATGCTGCTTTACTGGG - Intronic
1048700046 8:137078310-137078332 TGAGCATCTGCAGCTTTCCCGGG - Intergenic
1049221083 8:141429236-141429258 GGGGCACCTGCAGCTTTGCTGGG + Intronic
1049224451 8:141443127-141443149 TGGGCTGATTCAGCATTCTTGGG + Intergenic
1049250614 8:141586942-141586964 TCGGCAGATGCACCCGTCCTGGG - Intergenic
1049596200 8:143484638-143484660 CGGCCAGGTGCAGCTGTCCTTGG + Intronic
1050808789 9:9718502-9718524 TGGGCAGCTGCAGCTGTGCCTGG - Intronic
1056143460 9:83707266-83707288 CGGGCTGATGCCGCTTTTCTCGG - Intronic
1057231251 9:93322876-93322898 TGGGCAGATGAAGCTTCCAGTGG + Intronic
1057484232 9:95469656-95469678 TGGACAGAGGCTGCTTCCCTAGG - Intronic
1057792191 9:98131816-98131838 TGGGGAGAAGGAGCTTTCATTGG - Intronic
1060300487 9:122371929-122371951 TGGGTAGAAGCAGCTTTCTGTGG - Intronic
1062680439 9:137776343-137776365 CGGGCAGCCTCAGCTTTCCTGGG + Intronic
1186522655 X:10220077-10220099 AGGGGGGATGCAGCTTTTCTGGG + Intronic
1188042288 X:25382921-25382943 TGGGCAGAAGCAGCCTTCATGGG + Intergenic
1189280940 X:39819992-39820014 TGGGTAGATGCATTTTTCCGAGG - Intergenic
1191016248 X:55813356-55813378 TGGGCAGTTGCAGCTATGCCTGG - Intergenic
1194029253 X:88790436-88790458 TGGGCAGAAGGAGGTTCCCTTGG + Intergenic
1195322512 X:103731134-103731156 TGAAGAGATACAGCTTTCCTAGG + Intergenic
1196757562 X:119171268-119171290 TTGGCAGTGGCAGCCTTCCTCGG + Intergenic
1198342933 X:135732517-135732539 TGGGCAGAGGCTGCTTGGCTGGG - Intergenic
1198345056 X:135750778-135750800 TGGGCAGAGGCTGCTTGGCTGGG + Intergenic
1199872646 X:151912833-151912855 CGGGCAGCTGGGGCTTTCCTTGG - Intronic
1199950052 X:152699749-152699771 TGGACAGATGCAGTGGTCCTAGG + Intronic
1199959622 X:152768712-152768734 TGGACAGATGCAGTGGTCCTAGG - Intronic
1200163836 X:154022705-154022727 TTGGCAGATGCAGCTCTTCCTGG - Intronic
1202018945 Y:20444296-20444318 TGTGCAGATGCAACATCCCTGGG - Intergenic