ID: 1183707569

View in Genome Browser
Species Human (GRCh38)
Location 22:39483846-39483868
Sequence CAGGTAGAACAATCTGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 135}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183707569_1183707581 20 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707581 22:39483889-39483911 CTCCGTGTGGACAGCTCCAGGGG 0: 1
1: 0
2: 1
3: 13
4: 134
1183707569_1183707584 22 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707584 22:39483891-39483913 CCGTGTGGACAGCTCCAGGGGGG 0: 1
1: 0
2: 3
3: 12
4: 147
1183707569_1183707582 21 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707582 22:39483890-39483912 TCCGTGTGGACAGCTCCAGGGGG 0: 1
1: 0
2: 1
3: 18
4: 124
1183707569_1183707579 18 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707579 22:39483887-39483909 CACTCCGTGTGGACAGCTCCAGG 0: 1
1: 0
2: 0
3: 7
4: 112
1183707569_1183707576 7 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707576 22:39483876-39483898 TCAGCTGTGCCCACTCCGTGTGG 0: 1
1: 0
2: 1
3: 6
4: 147
1183707569_1183707585 26 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707585 22:39483895-39483917 GTGGACAGCTCCAGGGGGGCAGG 0: 1
1: 0
2: 1
3: 26
4: 354
1183707569_1183707580 19 Left 1183707569 22:39483846-39483868 CCTACCCCAGATTGTTCTACCTG 0: 1
1: 0
2: 0
3: 8
4: 135
Right 1183707580 22:39483888-39483910 ACTCCGTGTGGACAGCTCCAGGG 0: 1
1: 0
2: 0
3: 9
4: 115

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183707569 Original CRISPR CAGGTAGAACAATCTGGGGT AGG (reversed) Intronic
901700366 1:11042011-11042033 TAGGTAGAACAATGGGTGGTTGG + Intronic
903327446 1:22577522-22577544 CAGGGAGTACAGTCTGGGTTGGG + Intronic
909657141 1:78044841-78044863 CTGGTAGAATAAGCTGGAGTTGG + Intronic
909662050 1:78094980-78095002 CAGTTAAAACAATCTGTGTTGGG + Exonic
910524294 1:88160067-88160089 CAGGAAAAAAAATCTGAGGTTGG + Intergenic
911401243 1:97378148-97378170 CAGGTAAAACACTCTTGGCTTGG + Intronic
913100330 1:115558074-115558096 CAGCTAGAAAACTGTGGGGTTGG - Intergenic
915273676 1:154773477-154773499 CAGATAAAACAACCTGGGGCTGG + Intronic
918577496 1:186080531-186080553 CATGTAGAAAAATCTAGAGTGGG + Intronic
922333409 1:224597843-224597865 CAGGTAAAATGACCTGGGGTTGG + Intronic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
924240181 1:242032809-242032831 CAGGCAGATCAACCTGAGGTTGG + Intergenic
1068572368 10:58644357-58644379 CAGGTAGAAGAATCGGGGCCAGG - Intronic
1068987327 10:63119414-63119436 AAGGCAGACCAATCTGTGGTAGG - Intergenic
1071349314 10:84723643-84723665 CAGGTAAAACAACTTGGGGCGGG + Intergenic
1075220471 10:120580241-120580263 CAGGTAGTAAAATCTAGGGGAGG + Intronic
1075345760 10:121680975-121680997 CAGACAGAACAGTCTGGGATAGG + Intergenic
1075573448 10:123561276-123561298 CAGGTAGAACAGCCTGAGGCAGG - Intergenic
1080839108 11:35968040-35968062 GAGGTAGAAAAAATTGGGGTTGG - Intronic
1083073333 11:60010225-60010247 CAGGTACAACAATCAGTCGTAGG + Intergenic
1088911657 11:114196905-114196927 AAGGAAGACCAATCTGGGGCAGG + Intronic
1089416871 11:118299422-118299444 CAGTTAGAAGTATCTGTGGTGGG + Intergenic
1090128655 11:124116561-124116583 CTGGTAGAACAGGCTGGGCTGGG - Exonic
1090799491 11:130161434-130161456 CAGGGAGAACAAACTTGGGGTGG - Intronic
1092691988 12:11122596-11122618 CCTGTTGAAAAATCTGGGGTTGG + Intronic
1093197338 12:16144704-16144726 CAGTGAGAAAAATCTGGCGTAGG + Intergenic
1095881005 12:47135908-47135930 CAGGGAGAACCAGCTGTGGTTGG + Intronic
1096146057 12:49279735-49279757 CAGGTGGAACAAGCTGGGAATGG - Intergenic
1098170083 12:67738000-67738022 CAGACAGAACTATCTGGTGTAGG - Intergenic
1100122240 12:91382300-91382322 CAGGTAGAACAAAAGGGAGTGGG + Intergenic
1104364176 12:128161985-128162007 CGGATAGAACAATCGGGGGGAGG + Intergenic
1105226226 13:18435494-18435516 CAGGAAGAAAAAACTGAGGTGGG - Intergenic
1110532212 13:76610476-76610498 CAGGTATAACAAGCAGAGGTAGG + Intergenic
1113140712 13:107146228-107146250 CAGGTAGAACAAACAGGGAATGG + Intergenic
1113357905 13:109600887-109600909 CAGGTAGCAAAATCTGTTGTTGG + Intergenic
1114010682 14:18363878-18363900 CAGGAAGAAAAAACTGAGGTGGG - Intergenic
1114135923 14:19850425-19850447 CAGTTAGATCAGTCTGTGGTAGG + Intergenic
1114811944 14:25911234-25911256 CAGAGAGAACAATGTGGGTTTGG + Intergenic
1118875008 14:69776772-69776794 GAGGTAGATCAATTGGGGGTTGG - Intronic
1118892903 14:69924594-69924616 CAGGCAGAAGAATGTGGGGGAGG - Intronic
1119770761 14:77219467-77219489 CAGGAAAAGCAATGTGGGGTGGG - Intronic
1126401777 15:48278827-48278849 CAGATGGAACAATGAGGGGTGGG - Intronic
1126881272 15:53100841-53100863 CAGGTAGAGCAAACTGGGTCTGG + Intergenic
1129909992 15:79219337-79219359 CAGGCAGAACGATCTGGAGACGG - Intergenic
1131540323 15:93270110-93270132 CAGGTGGAACATTCGGGGATGGG + Intergenic
1132022748 15:98377190-98377212 TGGGTAGAGGAATCTGGGGTTGG - Intergenic
1132574814 16:659496-659518 CAGGTGGAACACAGTGGGGTCGG + Intronic
1132574831 16:659555-659577 CAGGTGGAACACGGTGGGGTCGG + Intronic
1133591484 16:7248531-7248553 CAGGTAAAACCATCTGTGATGGG - Intronic
1135603957 16:23807177-23807199 CAGGTGGAACAAGCTGGTGAGGG + Intergenic
1135772197 16:25226033-25226055 CACCTAGAACTATCTGGGCTGGG + Intronic
1140347559 16:74228657-74228679 CATGTAGCACAAACTGGGGATGG + Intergenic
1141078920 16:81034051-81034073 CAGGTGAAACAACCTGGGGCTGG - Intergenic
1143546607 17:7600410-7600432 CAGGCAGATCAATCCGAGGTTGG - Intronic
1145721626 17:27078454-27078476 CAGGTGGAGCAAATTGGGGTAGG - Intergenic
1150762410 17:67974545-67974567 CAGGTAAAACCACCTGGGGCTGG - Intronic
1150859536 17:68787011-68787033 CACGGAGAACAACCTGGTGTTGG + Intergenic
1150882395 17:69045317-69045339 CAGGAAGAACAATCATGGGGTGG - Exonic
1152361500 17:79835129-79835151 CAGGTCGTACATTTTGGGGTCGG + Exonic
1153758095 18:8303353-8303375 TGGCTAGAAGAATCTGGGGTAGG - Intronic
1154527155 18:15303988-15304010 CAGGAAGAAAAAACTGAGGTGGG + Intergenic
1156159822 18:34346217-34346239 CAGGTACAACAACTTGGAGTTGG - Intergenic
1156625008 18:38898186-38898208 CAGGAAGAAGAATCTGAGGGAGG + Intergenic
1157563948 18:48667366-48667388 CAGGTTGAACCATCTGGGAAAGG + Intronic
1162567946 19:11454357-11454379 CAGGGTGAGCACTCTGGGGTGGG - Exonic
1165217077 19:34282763-34282785 CAGGTAGAGAAATCAGGAGTGGG - Intronic
1166910978 19:46157157-46157179 CAGGTGCAACCATCTGGGCTTGG - Intronic
926004174 2:9359308-9359330 CATGGGGGACAATCTGGGGTAGG - Intronic
926288435 2:11509168-11509190 CAGAAAGAAAAATCTGGGGCCGG - Intergenic
927734533 2:25507438-25507460 TAGGTAGAACAAGCTTGGGTAGG - Intronic
928205466 2:29280393-29280415 CAGGTGGACCACTCTGGGATGGG + Intronic
931232800 2:60388679-60388701 GAGATAGAACAATCTGGGCCAGG + Intergenic
933430957 2:82178382-82178404 GAGGTATAATAATCTGGGGGAGG - Intergenic
937918264 2:127111184-127111206 CAGGTGGAGCAATTCGGGGTGGG + Intergenic
938526250 2:132135466-132135488 CAGGAAGAAAAAACTGAGGTGGG + Intergenic
940491743 2:154370622-154370644 AAGGAAGAACATTTTGGGGTTGG + Intronic
941267130 2:163376183-163376205 CAGGTAGAATAATCTGAGGAGGG + Intergenic
944020898 2:195102868-195102890 TAGGTAGGGCAACCTGGGGTCGG + Intergenic
946301841 2:218828610-218828632 CAGGGAGAACAGTCAAGGGTGGG + Intronic
948788230 2:240364201-240364223 CAGGTGGAAGGATCTGGGTTAGG - Intergenic
1168951932 20:1808303-1808325 AAGGCAGAAAGATCTGGGGTAGG + Intergenic
1169143349 20:3238185-3238207 AAGGGAGAACAATTGGGGGTGGG + Intronic
1169266892 20:4172431-4172453 CAGGAAGGAGAACCTGGGGTAGG + Intronic
1170031634 20:11950023-11950045 CAGATAAAACCGTCTGGGGTGGG - Intergenic
1174058317 20:47814997-47815019 CTGGTAGAAGGATCTGAGGTGGG + Intergenic
1174727204 20:52875515-52875537 CAGGTAGAAACATCTGGGGAAGG - Intergenic
1175270017 20:57727210-57727232 CCGGAAGAACCACCTGGGGTGGG + Intergenic
1175495681 20:59412606-59412628 CAGGGAGAGGAATTTGGGGTCGG - Intergenic
1176770280 21:13064520-13064542 CAGGAAGAAAAAACTGAGGTGGG - Intergenic
1177497504 21:21909179-21909201 GTGGTAGAAAAATTTGGGGTAGG + Intergenic
1180435175 22:15294681-15294703 CAGGAAGAAAAAACTGAGGTGGG - Intergenic
1180517372 22:16158498-16158520 CAGGAAGAAAAAACTGAGGTGGG - Intergenic
1183675466 22:39296882-39296904 CTGGCAGAACAGGCTGGGGTGGG - Intergenic
1183707569 22:39483846-39483868 CAGGTAGAACAATCTGGGGTAGG - Intronic
1184510543 22:44930716-44930738 CAGGCAGAGCACTCTGGGGCAGG + Intronic
1185125612 22:49009096-49009118 CAAGTACAACAAACTGGGGTGGG + Intergenic
952282620 3:31938315-31938337 TAGGTAGAAGGATCTGGGGTTGG - Intronic
952992334 3:38842572-38842594 AAGGTAGAGCAATAAGGGGTGGG + Intergenic
953470109 3:43159118-43159140 CTGGAAGACCATTCTGGGGTTGG - Intergenic
955981031 3:64528217-64528239 CAGGTAGAAGATTCTGGAATAGG - Intronic
959219017 3:103491323-103491345 CAGGAAGAATTAACTGGGGTAGG + Intergenic
959965237 3:112346654-112346676 CAGGTAGAAGACACTGGGTTGGG - Intronic
961738286 3:129015783-129015805 CAGGAAGAACAGCTTGGGGTAGG - Intronic
966470389 3:180282479-180282501 AAGGTAGAGCAATATGGGGCTGG + Intergenic
970011543 4:11464912-11464934 GAGGTAGAACTATCTGTGGAGGG + Intergenic
970244346 4:14043471-14043493 CAAGTAGAACAAACTCAGGTAGG - Intergenic
974714127 4:65644366-65644388 CAGGTAGAACCATGTGGGATAGG - Intronic
975106811 4:70576875-70576897 CAGGTAGATCTGTCTGGAGTAGG + Intergenic
977163394 4:93664627-93664649 CAGGAAGAATATTTTGGGGTGGG + Intronic
983715459 4:170776497-170776519 CAGATAGAAGACTCTGGAGTGGG - Intergenic
984960172 4:185089118-185089140 CAACTTGAACAATGTGGGGTGGG - Intergenic
988050017 5:26015640-26015662 CAGGTAGAAGAAAGTGGAGTGGG + Intergenic
992191533 5:74296715-74296737 CAGATTGAACAGTTTGGGGTGGG - Intergenic
992484475 5:77181287-77181309 CCGGGAGAACAGTCTGTGGTAGG + Intergenic
995131553 5:108636011-108636033 CAGGTAGACCAAGATGGGCTAGG + Intergenic
996838620 5:127822096-127822118 CAGGGACAACATTCTGGGCTTGG + Intergenic
1004764526 6:18710641-18710663 AAGGTAGAACAAACAGAGGTAGG - Intergenic
1004985724 6:21080016-21080038 CATGTAGAAAACTCTGGGCTTGG + Intronic
1005279255 6:24254225-24254247 TAGGTAGAACAGTCTCAGGTAGG - Intronic
1005708626 6:28481941-28481963 CAGAAAGAACAATTAGGGGTAGG - Intergenic
1013254370 6:108369904-108369926 CAGCCAGATCAATCTGGGGCTGG - Intronic
1013647263 6:112157158-112157180 CAGATAGCAAAATCTGGGGAAGG + Intronic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1022446347 7:30473764-30473786 TAGGTAGAATAAGCAGGGGTGGG + Intronic
1024578076 7:50781179-50781201 CAGGTAGCACAAGATGGGGAGGG + Intronic
1024968179 7:55043937-55043959 CAGGTTGAACAAGCTGAGGCAGG - Intronic
1032424274 7:131808334-131808356 CAGGTAGAAGAACCTGGGCCGGG + Intergenic
1032689031 7:134264081-134264103 CAGGTAGAACATTCTTCCGTGGG - Exonic
1034470144 7:151250494-151250516 CAGGTAAAAGAATCGGGGGCAGG - Intronic
1038027606 8:23606202-23606224 CAGGAATAACCATCTGGTGTTGG + Intergenic
1041355209 8:56993226-56993248 CAGGTAGAACATCTTGCGGTTGG + Exonic
1044209019 8:89527795-89527817 CAGATGGAAATATCTGGGGTTGG - Intergenic
1048548985 8:135416111-135416133 CTGGTACAACAGTCTGGGGATGG + Intergenic
1048621914 8:136142992-136143014 CAAGTAGAATGATCTGGGGTGGG + Intergenic
1050367807 9:4888656-4888678 TAGGGAGAACATTCAGGGGTTGG - Intergenic
1052034361 9:23663056-23663078 CAGGTAGAACAATCTGATCTTGG + Intergenic
1053277297 9:36793202-36793224 CAGGTGTAACAAAATGGGGTAGG + Intergenic
1053704947 9:40742802-40742824 CAGGAAGAAAAAACTGAGGTGGG + Intergenic
1054415024 9:64866409-64866431 CAGGAAGAAAAAACTGAGGTGGG + Intergenic
1057020873 9:91696912-91696934 TAGGCAGAACATTCTGGAGTGGG - Intronic
1062284310 9:135766293-135766315 CAGGGTGGACCATCTGGGGTGGG + Intronic
1195928868 X:110053366-110053388 CAGGAAGAACAAACTGATGTAGG + Intronic
1196106374 X:111900445-111900467 CAGGAAAAACAATCTGGTGAAGG + Intronic
1196270462 X:113704552-113704574 CAGGGTGAACAGTTTGGGGTTGG + Intergenic