ID: 1183708571

View in Genome Browser
Species Human (GRCh38)
Location 22:39489401-39489423
Sequence CTCTGTAAGTAGATGCATTT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 197
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 184}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183708555_1183708571 28 Left 1183708555 22:39489350-39489372 CCTGGGCCTTGGGCTCCGTGTGG 0: 1
1: 0
2: 1
3: 34
4: 274
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708563_1183708571 1 Left 1183708563 22:39489377-39489399 CCGGCCTGCCAGGAGGACCCAGG 0: 1
1: 0
2: 3
3: 51
4: 430
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708566_1183708571 -3 Left 1183708566 22:39489381-39489403 CCTGCCAGGAGGACCCAGGGCTC 0: 1
1: 0
2: 2
3: 48
4: 358
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708554_1183708571 29 Left 1183708554 22:39489349-39489371 CCCTGGGCCTTGGGCTCCGTGTG 0: 1
1: 0
2: 2
3: 32
4: 293
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708567_1183708571 -7 Left 1183708567 22:39489385-39489407 CCAGGAGGACCCAGGGCTCTGTA 0: 1
1: 0
2: 0
3: 17
4: 254
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708560_1183708571 13 Left 1183708560 22:39489365-39489387 CCGTGTGGGAGACCGGCCTGCCA 0: 1
1: 0
2: 0
3: 7
4: 110
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184
1183708558_1183708571 22 Left 1183708558 22:39489356-39489378 CCTTGGGCTCCGTGTGGGAGACC 0: 1
1: 0
2: 1
3: 8
4: 142
Right 1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG 0: 1
1: 0
2: 0
3: 12
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183708571 Original CRISPR CTCTGTAAGTAGATGCATTT GGG Exonic
901726654 1:11248189-11248211 CTTTGGAAGTAGTTGCGTTTCGG - Intronic
902970705 1:20046138-20046160 CTAGGTAAGTAGCTGAATTTGGG + Intronic
903197120 1:21699032-21699054 CTGTGCATGTACATGCATTTGGG - Intronic
904843031 1:33386148-33386170 CTTTGTAAGGGTATGCATTTTGG + Intronic
906583193 1:46953242-46953264 CTGTCTTTGTAGATGCATTTTGG - Intergenic
906601184 1:47130806-47130828 CTGTCTTTGTAGATGCATTTTGG + Intergenic
908709496 1:66999079-66999101 CTCATCAAGTAGAGGCATTTTGG - Intergenic
909940636 1:81607678-81607700 CTATGTAACTATATGCATTTTGG + Intronic
909975850 1:82045497-82045519 CTATGAAAGTAGAGACATTTAGG + Intergenic
910712735 1:90198586-90198608 CTCTGTAGGTAGGTGCAAATAGG + Intergenic
911333061 1:96547727-96547749 TTTTGTCAGTAGATGAATTTTGG - Intergenic
913081445 1:115391205-115391227 TGCTTTAAGTAGATGCATATGGG + Intergenic
913104556 1:115600500-115600522 ATCTTTAAGTAGATATATTTAGG - Intergenic
913135537 1:115884781-115884803 CTCTGTGAGTAGATACAGCTGGG - Intergenic
919121659 1:193348689-193348711 CTCTGTAAGTAGATTCTTGCTGG + Intergenic
920208699 1:204312742-204312764 CTCGGGAAGTGGCTGCATTTTGG - Intronic
920882373 1:209892299-209892321 CTATGTAAGTAGTTGTTTTTAGG + Intergenic
921372400 1:214437808-214437830 TTCTGTTAGTAGATGGATGTTGG - Intronic
923213036 1:231823098-231823120 TTCTGCAAGTAGCTGCATCTGGG - Intronic
924662843 1:246037715-246037737 CTCTGTAAGTTGCCCCATTTGGG + Intronic
1062843243 10:687142-687164 CTCTGAAAGCAGATACATTGAGG + Intronic
1068985320 10:63102844-63102866 CTCTGTAAGTACATAAAATTGGG - Intergenic
1070040100 10:72769359-72769381 CACTGCAGGTAGATGCATCTTGG + Intronic
1072565846 10:96616022-96616044 CTCTGTGGGAAGATGCATTGTGG + Intronic
1072788356 10:98300136-98300158 TTCTTTAACTATATGCATTTGGG + Intergenic
1073598438 10:104822977-104822999 CTCAGGAAGTACATGCATTCTGG + Intronic
1073928871 10:108550582-108550604 ATTTGAAAGCAGATGCATTTTGG - Intergenic
1075136564 10:119791517-119791539 CTCTGTAAGAAGCATCATTTTGG + Exonic
1076617966 10:131769414-131769436 CTCTCTAAGTAAATGGATATTGG + Intergenic
1080133170 11:28820099-28820121 CTCTGTGACTTGCTGCATTTTGG + Intergenic
1081523077 11:43901789-43901811 ATCTGAAAGTAGAAGCTTTTAGG - Intronic
1082123114 11:48401312-48401334 CTCTGTTATTAGATGCACATAGG - Intergenic
1082251663 11:49988849-49988871 CTCTGTTATTAGATGCACATAGG + Intergenic
1082556817 11:54572600-54572622 CTCTGTTATTAGATGCACATAGG - Intergenic
1082721671 11:56685079-56685101 ATCTGTAAGTAGATGATGTTTGG + Intergenic
1085324527 11:75596442-75596464 CTCTCTAAGGAGATGCAGTTGGG - Intronic
1087539120 11:99492241-99492263 CTCTGTAAGTTGATGCTCTCTGG + Intronic
1088336643 11:108712260-108712282 CTCTTTTAATTGATGCATTTAGG + Intronic
1092293830 12:7182499-7182521 CTCTCTTGGTAGATGGATTTTGG - Intergenic
1095107018 12:38246630-38246652 CTATGATAGTAGTTGCATTTGGG + Intergenic
1096019564 12:48312354-48312376 TTCTTTAAGTTGATACATTTGGG + Intergenic
1096952716 12:55490483-55490505 CTCTTGTAGTAGATGCATTAGGG + Intergenic
1097674628 12:62585785-62585807 CTCTGGAAGAAGATATATTTTGG - Intronic
1098655669 12:73026755-73026777 CTGTTTAAGCAGAAGCATTTAGG + Intergenic
1098875107 12:75858825-75858847 GTCTATAAGCAGAAGCATTTAGG - Intergenic
1099419059 12:82430021-82430043 CTTTGTAAGAAAATGCAATTGGG - Intronic
1099661108 12:85563398-85563420 CTATGTAAGTAAATACATTATGG - Intergenic
1103802781 12:123550165-123550187 CTCTCTTGGTAGATGGATTTTGG - Intergenic
1103888270 12:124219297-124219319 CTCTCTAAGAAGAGACATTTGGG - Intronic
1104765076 12:131325226-131325248 CTCAGTAAGTAGCTGAATTGGGG - Intergenic
1109494807 13:63155849-63155871 ATTTGTAAGTAGATACATGTTGG + Intergenic
1109732190 13:66428067-66428089 GGCTGTAAGTAGTAGCATTTTGG + Intronic
1110683135 13:78339922-78339944 CTCTGTATGTGCATTCATTTGGG + Intergenic
1113198884 13:107842183-107842205 ATCTGTGAGTATATGGATTTTGG - Intronic
1114073482 14:19133198-19133220 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1114088783 14:19266785-19266807 CTGTGTGGCTAGATGCATTTCGG - Intergenic
1114263917 14:21059964-21059986 CTCTGTATGTATATGCATATGGG - Intronic
1115749314 14:36472829-36472851 CTATGTAAATAGATACAGTTTGG + Intergenic
1116187241 14:41611924-41611946 CTCTGTCATTAAATGGATTTTGG + Intronic
1116402629 14:44527335-44527357 CTCTGTAAGCAGTTGAATTCTGG - Intergenic
1121847775 14:97188375-97188397 GCCTGGAAGAAGATGCATTTTGG + Intergenic
1125753715 15:42048113-42048135 CTCTATATTTAGATACATTTAGG + Intronic
1126477255 15:49078719-49078741 CTCTTTAAGGAGAAGTATTTGGG - Intergenic
1126477836 15:49084949-49084971 CTCTGTAAATAAATGCTTTGGGG - Intergenic
1126545405 15:49867767-49867789 CCCCGTAAGAAGATGCAATTAGG + Intronic
1128359351 15:66950020-66950042 ATATGTAAGAAGATGCCTTTAGG - Intergenic
1130289500 15:82584699-82584721 CTGTGTAGATAGATGCATTATGG - Intronic
1130642493 15:85691739-85691761 CTCAGTAAGTAGAAGCACCTGGG + Intronic
1131784399 15:95896277-95896299 CTTTGAAACTAAATGCATTTAGG - Intergenic
1135504792 16:23027192-23027214 CTCTGTCACAAGATGCATGTGGG + Intergenic
1135590352 16:23700790-23700812 CTCTGTAAGTTCATGCAGTCTGG - Intronic
1135604640 16:23812799-23812821 CTCTGTAAGTAAAGTCATCTCGG - Intergenic
1135923132 16:26669095-26669117 CTTTTTAAGAAGATGCAATTTGG - Intergenic
1136095449 16:27952353-27952375 CTCTGTAAGTAGGTTCCTCTGGG + Intronic
1137048200 16:35687433-35687455 CTCTGTAATTAGATTGCTTTGGG + Intergenic
1137051064 16:35713492-35713514 CTCTGTAATTAGAATTATTTGGG + Intergenic
1138242345 16:55437250-55437272 CTGTGTGAGTAAATGGATTTAGG + Intronic
1143347231 17:6258740-6258762 CACTGTAAGAAGAATCATTTTGG + Intergenic
1143834523 17:9679673-9679695 CTCGTTAAAAAGATGCATTTTGG - Intronic
1149205124 17:54234921-54234943 CACTGTGAGTAGATGCCATTAGG + Intergenic
1152680022 17:81662629-81662651 ATCAGTAAGTAGATTCATTGAGG + Intronic
1154957158 18:21270071-21270093 CTGTGTATGTACATGCATTTAGG + Intronic
1158659712 18:59375167-59375189 TTATGTAAGTAAATACATTTAGG + Intergenic
1159667968 18:71186660-71186682 CTCTGTATTTATATCCATTTTGG + Intergenic
1162530406 19:11232773-11232795 CTGTGTAGGTATATGCATGTGGG + Intronic
1166886828 19:45966566-45966588 TTCTTTAAATGGATGCATTTAGG - Intronic
926660121 2:15455942-15455964 TTCTGTTAGAAGAAGCATTTTGG - Intronic
927102635 2:19799815-19799837 CTCTGGAATGAGATGCACTTGGG - Intergenic
927362204 2:22249223-22249245 CTGTGTAAGTAGATTCCTGTAGG - Intergenic
928435813 2:31253802-31253824 CTCTGGATGCAGATGCATTGGGG + Intronic
928923478 2:36551701-36551723 CTGTGTAAGTACATGTATCTGGG + Intronic
929405060 2:41632013-41632035 GTCTGTTAGTAGAAACATTTGGG - Intergenic
930601526 2:53449267-53449289 CTCTGGAGGTATATGCATGTTGG + Intergenic
931390819 2:61842427-61842449 CTCTTTAAGAAGCAGCATTTTGG - Intronic
931911572 2:66905411-66905433 CTCTGTCAGTAGAGGCACCTGGG + Intergenic
931982325 2:67707186-67707208 CTCTCTAATTGGATCCATTTAGG - Intergenic
932238544 2:70140207-70140229 CTTTGTAGGTAGACGCTTTTTGG - Intergenic
932293887 2:70608485-70608507 CTGTGCAAGTAGATGGGTTTCGG - Intronic
933229114 2:79785407-79785429 CTCTGTCCCTAAATGCATTTAGG + Intronic
935876332 2:107511969-107511991 CTCTAGAAAGAGATGCATTTGGG + Intergenic
935965376 2:108467737-108467759 TTCTGTAAGTAGTTGGATATTGG + Intronic
940334575 2:152512003-152512025 CTCTGGATTTCGATGCATTTTGG + Intronic
940751634 2:157632733-157632755 CTCATGAAGTAGATGCATTGAGG - Intergenic
941579093 2:167272903-167272925 CTCTATTAGTAGCTCCATTTGGG - Intergenic
943545931 2:189277840-189277862 CTTTGGCAGTATATGCATTTGGG + Intergenic
944039573 2:195338555-195338577 CTCTTTTTGTAGATGGATTTTGG + Intergenic
944453189 2:199865030-199865052 TTTTGTAAGTAGATAGATTTGGG + Intergenic
944509729 2:200452953-200452975 CTCTGTATATATTTGCATTTAGG - Intronic
945478188 2:210311330-210311352 ATCAGTAAGTAAATGTATTTGGG + Intronic
948243479 2:236458075-236458097 CTTTGTAATTAGAACCATTTTGG - Intronic
948375238 2:237516743-237516765 CTCAGTGAGTAGATGGATTGTGG + Intronic
1168981817 20:2010495-2010517 CTCTCCCAGTAGATGCATTTAGG + Intergenic
1175990672 20:62786976-62786998 CTCTGGAAGATGATCCATTTGGG + Intergenic
1177023517 21:15893287-15893309 CTCTGTAATTTTATTCATTTTGG - Intergenic
1179280097 21:39926550-39926572 CTCTGGGAGTAGAAGGATTTGGG + Intronic
1180491924 22:15855551-15855573 CTGTGTGGCTAGATGCATTTCGG + Intergenic
1183708571 22:39489401-39489423 CTCTGTAAGTAGATGCATTTGGG + Exonic
949628829 3:5899663-5899685 CTCTGCAAGTAGTGACATTTTGG - Intergenic
949792712 3:7810667-7810689 CTCTGTCAGTAGAAGCATTAAGG - Intergenic
950174028 3:10859484-10859506 CTCTGCAAGTAGAGATATTTGGG + Intronic
951029435 3:17864463-17864485 GTCTGTAAATATATGCATATTGG + Intronic
951085775 3:18511063-18511085 TTCTCTAAGTGGCTGCATTTCGG - Intergenic
951287004 3:20825130-20825152 ATCTGTAACTAGATAGATTTAGG - Intergenic
951781162 3:26364199-26364221 CTATGTTAGTAGATGCAGTCTGG + Intergenic
952808393 3:37378951-37378973 CTCTGCAAGCAGCTGCATTTTGG + Intergenic
953791126 3:45949180-45949202 CTCTGCTTGTAGACGCATTTAGG - Intronic
954003453 3:47575672-47575694 CTGTGTGAGTGGCTGCATTTTGG + Intronic
956621975 3:71230346-71230368 CTATGTAAGTAGAGGCTTCTTGG - Intronic
963346900 3:144105690-144105712 CTGTTTAACTAGATGCCTTTTGG + Intergenic
963863358 3:150333528-150333550 GTTTGTAAATAGATTCATTTTGG - Intergenic
964261610 3:154845308-154845330 CTCTGTATGCATGTGCATTTTGG - Intergenic
967490937 3:190090051-190090073 CTCTGTAGGTAGATTTATTTGGG + Intronic
967551619 3:190801631-190801653 CTATGTAAGAAGCTCCATTTTGG + Intergenic
973113635 4:46427483-46427505 AATTGTAAGAAGATGCATTTTGG - Intronic
973161747 4:47026766-47026788 CTGTATAATTAAATGCATTTAGG - Intronic
973701297 4:53539880-53539902 CTCTGTAACCAGCTGCAATTAGG + Intronic
974151218 4:58011862-58011884 CTCTGTAGATAGATTAATTTGGG - Intergenic
975461825 4:74662380-74662402 CTATGTAAGTAAATCCCTTTAGG - Intergenic
976969442 4:91087116-91087138 TTCTATAAGTAGATCCATTTTGG - Intronic
979845914 4:125511757-125511779 CTTTCTCAGTAGATGAATTTAGG - Intergenic
981543597 4:145871772-145871794 CCCTGTAAGAATATGCATTCTGG + Intronic
982116344 4:152101476-152101498 CCCTGTAGGTAGAAGCATATGGG + Intergenic
982734584 4:158992271-158992293 CTCTGTAGTCAAATGCATTTGGG + Intronic
982906317 4:161078876-161078898 ATCAGTAAGTAGATGAATTGAGG + Intergenic
983478711 4:168246653-168246675 CTATGGCAGTAGAAGCATTTAGG - Intronic
985489942 5:173316-173338 CTCAGTCAGTAACTGCATTTTGG + Intronic
985833786 5:2256220-2256242 CTCTGTATGTGCATGCATATGGG + Intergenic
989819287 5:45775753-45775775 CTCTGTGAGTACATGTATATGGG - Intergenic
990287191 5:54311468-54311490 ATCTATAAGCAGATGCATTTGGG + Intergenic
990315541 5:54579526-54579548 CTCTGTAAATAGATGGATGAAGG - Intergenic
990373644 5:55147655-55147677 CTAAGTAAGTAGTGGCATTTTGG - Intronic
991023988 5:62010044-62010066 CTTTGTAAGTACCTGCCTTTTGG + Intergenic
991503616 5:67302257-67302279 CTCTGTAACTATAGGCTTTTTGG - Intergenic
993301158 5:86212270-86212292 TTCTGTAAGTAGATGTAATGTGG + Intergenic
994141984 5:96351927-96351949 CTCTGCAATTAAAGGCATTTCGG - Intergenic
995987499 5:118196659-118196681 CTCTTTGAGAAGATGGATTTAGG - Intergenic
998724769 5:144998131-144998153 CTCTGTTATTAGGTACATTTAGG + Intergenic
998744224 5:145238484-145238506 ATGTGTAAATAAATGCATTTAGG - Intergenic
1001021426 5:168186158-168186180 CTCTGGAATCAGATGGATTTGGG - Intronic
1001209035 5:169793196-169793218 CTGTGTAAGCATATGCATTTTGG - Intronic
1001537749 5:172510027-172510049 CTCTTTATATTGATGCATTTAGG + Intergenic
1002720412 5:181257262-181257284 TTCTGTAAGAAGAGGCTTTTTGG - Exonic
1009033589 6:58090146-58090168 CTCTGTAGCTAGAGGCAGTTTGG - Intergenic
1009209202 6:60841855-60841877 CTCTGTAGCTAGAGGCAGTTTGG - Intergenic
1009820307 6:68791263-68791285 CTCTGTAATTACGTGCATATGGG - Intronic
1011190095 6:84719407-84719429 CTCTTTTTGTAGATGGATTTTGG + Intronic
1014595957 6:123338986-123339008 AACTGTAAGTAGATGTATTAGGG + Intronic
1014925426 6:127265221-127265243 CTTTTTAAGTAGATTTATTTAGG + Intergenic
1015782148 6:136879627-136879649 CTCTTTAAGTATATAGATTTGGG + Intronic
1017573757 6:155778562-155778584 CTCTGTGAGGAAATGGATTTGGG - Intergenic
1017612777 6:156208606-156208628 ATCTTTAAAAAGATGCATTTTGG + Intergenic
1018557526 6:165064405-165064427 CTCTGTAAGGTCCTGCATTTGGG + Intergenic
1021292591 7:18864684-18864706 CTCTGTAAGTAGAGCATTTTGGG - Intronic
1023439555 7:40172017-40172039 CTCTTTTGGTAGATGGATTTTGG + Intronic
1024054358 7:45650430-45650452 CTCTGTAGGTGGATGCTTTAAGG + Intronic
1024333749 7:48182444-48182466 CACTGGAAGGAGATGCATATTGG - Intronic
1030705889 7:112692419-112692441 CTCTCTAAGTAGCTCCACTTGGG - Intergenic
1032632142 7:133664942-133664964 TTTTGTAAGTACATGCATTTTGG + Intronic
1036707553 8:11056525-11056547 CTCTTTGAGGAGTTGCATTTGGG - Intronic
1042314066 8:67407163-67407185 CTCTGTAGGTAGAAACATTGGGG - Intergenic
1043194979 8:77280714-77280736 CTTTGTAAGAAGAAGCAGTTTGG - Intergenic
1046084828 8:109419597-109419619 CAATGTCAGTAGTTGCATTTTGG - Intronic
1047444175 8:124905120-124905142 CTCTTTTTGTAGATGGATTTTGG + Intergenic
1048102506 8:131369230-131369252 TTCTGTAAGTGGAAGCATTCTGG + Intergenic
1049740093 8:144235437-144235459 CTCTTTGTGTAGAAGCATTTAGG + Intronic
1050994687 9:12201268-12201290 ATTTTTAAGTAAATGCATTTGGG - Intergenic
1054971189 9:71089481-71089503 CTCTGTAGCTAGAGGCATCTAGG + Intronic
1185970786 X:4660571-4660593 CTCTCCAATTACATGCATTTTGG - Intergenic
1186061940 X:5718463-5718485 CTCTGTATGTTCCTGCATTTTGG - Intergenic
1186412532 X:9356541-9356563 TTCTGTATGTAGATGGACTTTGG + Intergenic
1189411209 X:40773319-40773341 CTCTGTGAGGAGATGCCGTTAGG - Intergenic
1190247225 X:48698634-48698656 CTCTGGAAATAGATTCCTTTAGG + Intronic
1191965998 X:66758845-66758867 CTCTGTATTTAAATACATTTGGG - Intergenic
1193594369 X:83428170-83428192 CACTGTAAATATATGAATTTTGG - Intergenic
1193974340 X:88099087-88099109 CTAGGTAAGTAGATGAATTGGGG - Intergenic
1195906071 X:109845772-109845794 TTCTGGAAGTAGATGAATCTGGG - Intergenic
1197981844 X:132225377-132225399 CTCTGTAAGAGGAGGCATTGGGG + Intergenic