ID: 1183710569

View in Genome Browser
Species Human (GRCh38)
Location 22:39501149-39501171
Sequence GGGGAGGCCCTTACCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 106}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183710569_1183710579 24 Left 1183710569 22:39501149-39501171 CCAGTTCTGGTAAGGGCCTCCCC 0: 1
1: 0
2: 0
3: 9
4: 106
Right 1183710579 22:39501196-39501218 TCACTCAGCTGCGAAAGCACTGG 0: 1
1: 0
2: 0
3: 13
4: 160

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183710569 Original CRISPR GGGGAGGCCCTTACCAGAAC TGG (reversed) Intronic
901882438 1:12202141-12202163 GGGGAGGCCCGGGCCAGCACCGG + Exonic
902717190 1:18280895-18280917 GGGCAGGCCCTGCCCAGAAGGGG - Intronic
905691410 1:39945856-39945878 GGGAAGGCCCTAAACACAACTGG - Intergenic
914816549 1:151067269-151067291 GAGGATGCCCATCCCAGAACTGG + Exonic
919757370 1:201074427-201074449 AGGGAGGCCCTGTCCAGAGCTGG + Intronic
922582913 1:226711949-226711971 AGGGAGGCCTTTTGCAGAACAGG - Intronic
922998056 1:229982604-229982626 CCTGAGGCCCTTACCAGAAGCGG - Intergenic
1067090461 10:43263727-43263749 GGGGAGAAGCTTCCCAGAACAGG + Intronic
1067161037 10:43825536-43825558 GGGGAGGCCCAGAGCAGAGCGGG + Intergenic
1070401028 10:76053744-76053766 AGGGCAGCCCTTAGCAGAACTGG + Intronic
1076221394 10:128735942-128735964 GGGGAGGCCATTACCAAGCCGGG - Intergenic
1076374134 10:129972484-129972506 GGGGAGGCGCGTACCGGCACGGG - Intergenic
1077184447 11:1229976-1229998 AGGGAGGCCGTGAGCAGAACCGG - Intronic
1078352370 11:10604742-10604764 CGCTAGGCCCTTCCCAGAACCGG + Intronic
1080590276 11:33717356-33717378 GGGGAGGCTCTTACCAGCTTTGG + Exonic
1081469416 11:43356027-43356049 CGTGAGGCCCTTACCAGATGCGG + Intergenic
1082615657 11:55356570-55356592 TGGGAGGCCCTGACCAGTAAGGG - Intergenic
1083753190 11:64774101-64774123 TGGGAGACCCTTACTAGTACAGG - Intronic
1083993060 11:66258287-66258309 GGGGACCCCCTAACCAGGACAGG - Intronic
1088597118 11:111449132-111449154 AGCCAGACCCTTACCAGAACAGG + Intronic
1089118399 11:116114321-116114343 GGGGGTGCCCTGACCAAAACTGG - Intergenic
1089270871 11:117300465-117300487 GGGGGGGCTCTTAACAGGACGGG + Intronic
1089619749 11:119715296-119715318 TGGGAGGCTCTTTCCAGACCTGG + Intronic
1090406592 11:126479416-126479438 GGGGAGGCCCTTGCCACTCCAGG + Intronic
1096846946 12:54412569-54412591 GGGGAGGCCCACACCAGGGCCGG - Intronic
1101987743 12:109460852-109460874 TGGGAGGCCCTGAGCAGAGCTGG + Intronic
1103046155 12:117736366-117736388 GGGCAGGCTCTTGCCAGAAGAGG - Intronic
1103414876 12:120737257-120737279 GGGTAGGCCCTGGACAGAACAGG + Intronic
1106306494 13:28515707-28515729 GTGGAGGCCCCCACTAGAACTGG + Intergenic
1112087534 13:96047205-96047227 GGGGAGGCACTTCCCAGTAGGGG + Intronic
1114265269 14:21069891-21069913 GGGCCGCCCCTTCCCAGAACTGG - Intronic
1122232939 14:100316141-100316163 AGGGAGGCCCTCTCCAGAGCAGG - Intergenic
1125766638 15:42140892-42140914 GGAGAGGGCCTGGCCAGAACGGG + Exonic
1130108217 15:80944896-80944918 GGGGAAGCCCTTACTGGAATGGG + Intronic
1130550358 15:84886609-84886631 GGGGAGGCGCTGGGCAGAACTGG + Intronic
1131044681 15:89304703-89304725 GTGGAGTGCCTAACCAGAACAGG - Intronic
1131373069 15:91899750-91899772 GGGCAGGAACTTACCACAACTGG - Intronic
1133771942 16:8871774-8871796 GGGGAGGCCATGACCAGGAGGGG + Intergenic
1135750556 16:25055326-25055348 GGGGAGGCCTCTCTCAGAACGGG - Intergenic
1136025530 16:27465869-27465891 GGGGAGTCCCTGACCAGGGCTGG + Intronic
1141324812 16:83046617-83046639 GGGAAGGCCTTTAACAGAGCAGG + Intronic
1142211342 16:88810056-88810078 GGGGAGACCCTTACCACCAGTGG + Exonic
1142341006 16:89522664-89522686 GATGACGCCCTTCCCAGAACTGG + Intronic
1146517511 17:33500850-33500872 GGTGAGGCCCTTTCCAGCACTGG - Intronic
1148327695 17:46793305-46793327 GGGGAGACATTTACCAGGACAGG + Intronic
1148461483 17:47841254-47841276 GGGGCGGCCCTGGCCAGAAGCGG - Exonic
1150895313 17:69203412-69203434 GGTGAGGCACTGACCAGGACAGG - Intronic
1151077543 17:71290949-71290971 GGCCAGCCCCTGACCAGAACTGG + Intergenic
1152533755 17:80938184-80938206 GAGGGGGCCCATGCCAGAACAGG - Intronic
1162327685 19:10008489-10008511 GTGGGGGCCCTGACCAGCACAGG - Intronic
1165058972 19:33195554-33195576 AGGGAGGCCATTATAAGAACTGG + Intronic
1165725136 19:38107378-38107400 GGGGAGGTGCTTTCCTGAACTGG + Intronic
1166560098 19:43727119-43727141 GTGGTGACCCTTAGCAGAACAGG - Intergenic
926139495 2:10359818-10359840 GGGAGGGCCCTTTCCAGAGCAGG + Intronic
927217711 2:20677858-20677880 GGGGAGGCCCTCAACACACCTGG - Intergenic
929885355 2:45873060-45873082 GGGTAGGCCCTTAGCAGACCTGG - Intronic
932214769 2:69959507-69959529 GGGGAGGACATTCCCAGATCTGG - Intergenic
933220340 2:79680360-79680382 TGAGAGGCCCCTAGCAGAACAGG - Intronic
935434223 2:103011103-103011125 GGAGAGCCGCTTAGCAGAACAGG - Intergenic
935864035 2:107365729-107365751 TCGGAAGCCCTTACCAGAAGAGG + Intergenic
937446361 2:121962052-121962074 TGGAATGCCCTTACCAGAGCTGG - Intergenic
938033689 2:128017801-128017823 GGATAGGGCCTTACCACAACAGG + Exonic
945908194 2:215617596-215617618 GGGGAGTCTCTTCCCAGACCTGG - Intergenic
946409078 2:219507555-219507577 GGTGAGGGCCTTCCCAGAACAGG - Intergenic
1172973616 20:38890820-38890842 GGAGAGGCCCTCACCAGCCCAGG - Intronic
1175898736 20:62351658-62351680 GGGGGGGGCCTCACCTGAACGGG + Intronic
1177862142 21:26466794-26466816 AGGGAGCCCCTCACCAGAACAGG + Exonic
1179096006 21:38314788-38314810 GGGGAGCCACTTACCAGAGTGGG - Intergenic
1180620744 22:17159997-17160019 GTGGAGGCCCTTAGCAGAGCTGG + Intronic
1183710569 22:39501149-39501171 GGGGAGGCCCTTACCAGAACTGG - Intronic
1185297952 22:50063588-50063610 TCGGAGGCCCTCACCAGGACAGG + Intronic
953771245 3:45779980-45780002 CGGGGGGCCCGTGCCAGAACAGG - Intronic
954308826 3:49748567-49748589 GGAGAGACCCTTACCAGTACTGG - Intronic
956671820 3:71698470-71698492 TGGGATGCTCTTACCAGAAAGGG - Intronic
957963783 3:87295501-87295523 CCTGAGGCCCTTACCAGAAATGG - Intergenic
961602451 3:128072244-128072266 GGTGAGGCCCTGTCCAGGACTGG - Intronic
965678779 3:171229347-171229369 GGGGAGGCCCTTACTATTCCAGG - Intronic
967756707 3:193178356-193178378 GGGGCGGCCTCTACCAGAAAGGG - Intergenic
969567509 4:7987476-7987498 GGGGGTTCCCTGACCAGAACAGG - Intronic
981668292 4:147255764-147255786 TGGGAGGCACTTCCCAGAAGGGG + Intergenic
987324955 5:16804257-16804279 GGTGAGGCCCTGAGCAGACCAGG - Intronic
988780993 5:34521784-34521806 GGTGAGGCCTCTACCAGAAGCGG + Intergenic
994759577 5:103836072-103836094 TGAGAGGCCCTTCCCAGAACTGG + Intergenic
998172308 5:139879872-139879894 GGGGTGTCCCTCACCAGGACAGG + Intronic
1002939795 6:1705925-1705947 AGGAAGGCCCTTGCAAGAACAGG + Intronic
1003016920 6:2475457-2475479 GGGGAGGCCCATGCCAGGATGGG + Intergenic
1003765776 6:9234853-9234875 GGTGAGGCTCTTAACTGAACTGG + Intergenic
1009038285 6:58144889-58144911 CCTGAGGCCCTTACCAGAAGTGG + Intergenic
1009214076 6:60898519-60898541 CCTGAGGCCCTTACCAGAAGTGG + Intergenic
1010496369 6:76537724-76537746 GGGGAGAACCCCACCAGAACTGG - Intergenic
1016574591 6:145554623-145554645 AAGGAAGCCCTTGCCAGAACTGG - Intronic
1017403574 6:154092577-154092599 GGGGAGGCCTTTGCCACCACAGG + Intronic
1017648205 6:156557937-156557959 AGAGAGGCCCTTAACACAACAGG + Intergenic
1018681516 6:166269566-166269588 GGAGGGGCTCTTACCAGAAAGGG + Intergenic
1019270252 7:143172-143194 CGGGTGGCCCTTCACAGAACAGG + Intergenic
1022843669 7:34189635-34189657 GGGGAGGGTCTTACCAGGGCTGG + Intergenic
1024250968 7:47505433-47505455 GGGGAAGCCCTCTCCAGAGCAGG + Intronic
1034456999 7:151176016-151176038 GGGAGGGCCCTAGCCAGAACCGG - Intronic
1036752302 8:11451056-11451078 GGGGATGCACTTTCCAGAAGAGG - Intronic
1038090981 8:24252744-24252766 GGGGAGGCCCTCACCAGAGGTGG - Intergenic
1040891046 8:52316348-52316370 GGGGGAGCCCCTACCAGCACAGG - Intronic
1044803828 8:95984275-95984297 GGGGAAGCCCTTCAGAGAACTGG - Intergenic
1044837986 8:96314436-96314458 GGGGGGTCCCTTCCCAGCACAGG + Intronic
1044875762 8:96664804-96664826 GGGGAGGCCCTTCACTGGACAGG + Intronic
1045260610 8:100570225-100570247 GGGAAGGCCCTGACCAGAGCTGG - Intergenic
1046658966 8:116927967-116927989 GGGCAGTCCCTGCCCAGAACAGG + Intergenic
1050334582 9:4578010-4578032 TGGGTGGGGCTTACCAGAACAGG + Intronic
1053296424 9:36917451-36917473 GGGGATTCCCTTACAAAAACTGG - Intronic
1053355340 9:37441010-37441032 GTGGAGGCCCAAACCAGACCTGG + Exonic
1056589952 9:87958879-87958901 AGGAAGGCCATTATCAGAACTGG - Intergenic
1061682730 9:132250903-132250925 GGGGAGGCCCTGAGCAGGGCTGG + Intergenic
1062285709 9:135771682-135771704 GGGGAGCCGCTTACCAGACAGGG + Intronic
1185504423 X:620568-620590 GCGGAGGCCCGTGCCAGAAGTGG + Intergenic
1190745682 X:53320746-53320768 GGGAAGGCGCCTACCAGAATCGG - Exonic
1191943156 X:66501402-66501424 GGGAAGGCCCTGAACATAACTGG + Intergenic
1199597096 X:149514628-149514650 GAGGACGCCCTTCCCAGGACAGG - Intronic