ID: 1183714267

View in Genome Browser
Species Human (GRCh38)
Location 22:39524549-39524571
Sequence AGTGGGGGTCGGCCCTCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183714259_1183714267 4 Left 1183714259 22:39524522-39524544 CCAGGAGCATCAGAGTCATCCAG No data
Right 1183714267 22:39524549-39524571 AGTGGGGGTCGGCCCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183714267 Original CRISPR AGTGGGGGTCGGCCCTCATT TGG Intergenic