ID: 1183715967

View in Genome Browser
Species Human (GRCh38)
Location 22:39533855-39533877
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183715960_1183715967 24 Left 1183715960 22:39533808-39533830 CCTGGCATGGAGAAGACACGCAA No data
Right 1183715967 22:39533855-39533877 ACCACTGGGTTCACTCAGCCGGG No data
1183715959_1183715967 30 Left 1183715959 22:39533802-39533824 CCAGCACCTGGCATGGAGAAGAC No data
Right 1183715967 22:39533855-39533877 ACCACTGGGTTCACTCAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183715967 Original CRISPR ACCACTGGGTTCACTCAGCC GGG Intergenic