ID: 1183716934

View in Genome Browser
Species Human (GRCh38)
Location 22:39538562-39538584
Sequence CCTTGTCCACAGATGGAGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183716934_1183716939 -3 Left 1183716934 22:39538562-39538584 CCCTGCTCCATCTGTGGACAAGG No data
Right 1183716939 22:39538582-39538604 AGGAGCCAAAAAGATGGTGTAGG No data
1183716934_1183716938 -9 Left 1183716934 22:39538562-39538584 CCCTGCTCCATCTGTGGACAAGG No data
Right 1183716938 22:39538576-39538598 TGGACAAGGAGCCAAAAAGATGG No data
1183716934_1183716941 11 Left 1183716934 22:39538562-39538584 CCCTGCTCCATCTGTGGACAAGG No data
Right 1183716941 22:39538596-39538618 TGGTGTAGGACGTACCTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183716934 Original CRISPR CCTTGTCCACAGATGGAGCA GGG (reversed) Intergenic
No off target data available for this crispr