ID: 1183717727

View in Genome Browser
Species Human (GRCh38)
Location 22:39543666-39543688
Sequence CTTTGAGCCCAGCAGGAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183717727_1183717731 2 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717731 22:39543691-39543713 TCTCTCCGGAGAGGTGTGTTTGG No data
1183717727_1183717736 20 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717736 22:39543709-39543731 TTTGGCCCAGGCCAGCCCAGGGG No data
1183717727_1183717734 18 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717734 22:39543707-39543729 TGTTTGGCCCAGGCCAGCCCAGG No data
1183717727_1183717730 -7 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717730 22:39543682-39543704 CTCAAAGATTCTCTCCGGAGAGG No data
1183717727_1183717733 8 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717733 22:39543697-39543719 CGGAGAGGTGTGTTTGGCCCAGG No data
1183717727_1183717735 19 Left 1183717727 22:39543666-39543688 CCATCTTCCTGCTGGGCTCAAAG No data
Right 1183717735 22:39543708-39543730 GTTTGGCCCAGGCCAGCCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183717727 Original CRISPR CTTTGAGCCCAGCAGGAAGA TGG (reversed) Intergenic
No off target data available for this crispr