ID: 1183718179

View in Genome Browser
Species Human (GRCh38)
Location 22:39546541-39546563
Sequence CTGGAGGGTCAGGATGCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183718168_1183718179 -5 Left 1183718168 22:39546523-39546545 CCTCCCCACCAGTTTTCTCTGGA No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data
1183718172_1183718179 -9 Left 1183718172 22:39546527-39546549 CCCACCAGTTTTCTCTGGAGGGT No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data
1183718165_1183718179 -1 Left 1183718165 22:39546519-39546541 CCACCCTCCCCACCAGTTTTCTC No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data
1183718170_1183718179 -8 Left 1183718170 22:39546526-39546548 CCCCACCAGTTTTCTCTGGAGGG No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data
1183718173_1183718179 -10 Left 1183718173 22:39546528-39546550 CCACCAGTTTTCTCTGGAGGGTC No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data
1183718166_1183718179 -4 Left 1183718166 22:39546522-39546544 CCCTCCCCACCAGTTTTCTCTGG No data
Right 1183718179 22:39546541-39546563 CTGGAGGGTCAGGATGCAGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183718179 Original CRISPR CTGGAGGGTCAGGATGCAGG GGG Intergenic
No off target data available for this crispr