ID: 1183725601

View in Genome Browser
Species Human (GRCh38)
Location 22:39587557-39587579
Sequence CTGTGGCCACAGGTGGAATG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183725594_1183725601 -1 Left 1183725594 22:39587535-39587557 CCATGCCTGTCTCCCGAGGCAGC No data
Right 1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG No data
1183725595_1183725601 -6 Left 1183725595 22:39587540-39587562 CCTGTCTCCCGAGGCAGCTGTGG 0: 1
1: 0
2: 1
3: 22
4: 223
Right 1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG No data
1183725592_1183725601 26 Left 1183725592 22:39587508-39587530 CCATAAAGTGGGGTGTAATAATG 0: 1
1: 0
2: 0
3: 12
4: 157
Right 1183725601 22:39587557-39587579 CTGTGGCCACAGGTGGAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183725601 Original CRISPR CTGTGGCCACAGGTGGAATG AGG Intronic
No off target data available for this crispr