ID: 1183725981

View in Genome Browser
Species Human (GRCh38)
Location 22:39589982-39590004
Sequence TCTGTGATTCGGGGGGCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183725981_1183725995 16 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725995 22:39590021-39590043 GGCCTGCAGAAGGAGGGTGGTGG No data
1183725981_1183725997 25 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725997 22:39590030-39590052 AAGGAGGGTGGTGGTCGCCATGG No data
1183725981_1183725991 9 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725991 22:39590014-39590036 TCGCCTGGGCCTGCAGAAGGAGG No data
1183725981_1183725988 -6 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725988 22:39589999-39590021 CACAGAAACTGAGTGTCGCCTGG No data
1183725981_1183725990 6 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725990 22:39590011-39590033 GTGTCGCCTGGGCCTGCAGAAGG No data
1183725981_1183725989 -5 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725989 22:39590000-39590022 ACAGAAACTGAGTGTCGCCTGGG No data
1183725981_1183725994 13 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725994 22:39590018-39590040 CTGGGCCTGCAGAAGGAGGGTGG No data
1183725981_1183725992 10 Left 1183725981 22:39589982-39590004 CCCAGAGCCCCCCGAATCACAGA No data
Right 1183725992 22:39590015-39590037 CGCCTGGGCCTGCAGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183725981 Original CRISPR TCTGTGATTCGGGGGGCTCT GGG (reversed) Intronic