ID: 1183729847

View in Genome Browser
Species Human (GRCh38)
Location 22:39612014-39612036
Sequence GGTTGCCAACACATGAACTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 795
Summary {0: 1, 1: 0, 2: 13, 3: 195, 4: 586}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183729847_1183729851 8 Left 1183729847 22:39612014-39612036 CCATAGTTCATGTGTTGGCAACC 0: 1
1: 0
2: 13
3: 195
4: 586
Right 1183729851 22:39612045-39612067 AGTGCAACAGAGTTGAGAGGTGG 0: 2
1: 21
2: 165
3: 445
4: 902
1183729847_1183729852 9 Left 1183729847 22:39612014-39612036 CCATAGTTCATGTGTTGGCAACC 0: 1
1: 0
2: 13
3: 195
4: 586
Right 1183729852 22:39612046-39612068 GTGCAACAGAGTTGAGAGGTGGG No data
1183729847_1183729850 5 Left 1183729847 22:39612014-39612036 CCATAGTTCATGTGTTGGCAACC 0: 1
1: 0
2: 13
3: 195
4: 586
Right 1183729850 22:39612042-39612064 CCAAGTGCAACAGAGTTGAGAGG 0: 1
1: 2
2: 28
3: 211
4: 658
1183729847_1183729853 29 Left 1183729847 22:39612014-39612036 CCATAGTTCATGTGTTGGCAACC 0: 1
1: 0
2: 13
3: 195
4: 586
Right 1183729853 22:39612066-39612088 GGGACCTTTAAGAAGTGACCAGG 0: 1
1: 1
2: 41
3: 285
4: 881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183729847 Original CRISPR GGTTGCCAACACATGAACTA TGG (reversed) Intronic
900723996 1:4202917-4202939 GGTTTCCAACATATGAACTGTGG + Intergenic
900821328 1:4891266-4891288 AGCTTCCAACACATGAACTTTGG + Intergenic
902415105 1:16233822-16233844 AGTTTCCAACACATGAACTCTGG - Intronic
903030453 1:20460316-20460338 AGTTTCCAACACATGAGCTTTGG - Intergenic
904315836 1:29662396-29662418 AGTTTCCAACACATGAAATTTGG - Intergenic
904691382 1:32295697-32295719 TGTTTCCAACACATGAATTTTGG + Intronic
904985518 1:34545101-34545123 AGTTTCCAACACATGAAATTTGG - Intergenic
905472143 1:38201297-38201319 AGCTTCCAACACATGAACTTTGG + Intergenic
905967299 1:42109577-42109599 AGTTTCCAACACATGAAATTTGG - Intergenic
906629908 1:47357905-47357927 AGTTTCCAACACAGGAACTTGGG + Intronic
907097541 1:51795467-51795489 GGTGGCCAAGACAGAAACTAAGG + Intronic
908034525 1:60037675-60037697 AGCTTCCAACACATGAACTTTGG + Intronic
908849322 1:68358768-68358790 GGTTGCCCACGCATCAAATATGG - Intergenic
908970009 1:69816389-69816411 GGATTTCAACACATGAACTTGGG + Intronic
909145960 1:71931724-71931746 ATTTTCCAACACATGAACTTTGG + Intronic
909407856 1:75312384-75312406 AGTTTCCAACACATGAACCTTGG - Intronic
909418793 1:75439005-75439027 AGTTGTCAATACATGAACTTTGG - Intronic
909455810 1:75847225-75847247 AGTTTCCAACACATGAACGTTGG + Intronic
909513382 1:76479743-76479765 AGTTTCCAACAGATGAACTTTGG + Intronic
909542406 1:76805819-76805841 AGTTTCCAACACATAAACTTTGG - Intergenic
909542691 1:76808192-76808214 AGTTTCTAACACATGAACTTTGG - Intergenic
910015472 1:82518548-82518570 AGTTTCCAACACATGAATTTGGG - Intergenic
910219396 1:84875350-84875372 AGTTTCCAACACATGAACTCTGG - Intronic
911713118 1:101097869-101097891 AGTTTCCAACACATGAACCTTGG - Intergenic
912130995 1:106600253-106600275 AGTTTTCAACACATGAACTTTGG - Intergenic
914453706 1:147816122-147816144 AGTTTCTAACACATGAACTTTGG + Intergenic
914454010 1:147818566-147818588 AGTTTCCAACACATGAACTTTGG + Intergenic
915110326 1:153560536-153560558 AGTTTCCAACACATGAACTTTGG + Intergenic
916279786 1:163036980-163037002 AGTTTCCAACACATGACCTTTGG + Intergenic
916484425 1:165245428-165245450 GGTTGCCGACCCATGTACTGGGG - Intronic
916811259 1:168307544-168307566 AGTTCCCAACACATGAACCTTGG + Intronic
918010571 1:180582892-180582914 GGTTTTCAACACAAGAACTTTGG - Intergenic
918189737 1:182162664-182162686 AGTTTCCAACACCTGAACTTTGG - Intergenic
918327978 1:183428264-183428286 AGTTTCCAACACATGAACTTTGG - Intergenic
918347871 1:183622212-183622234 GGTTGTCAAAAGAGGAACTAGGG + Intergenic
918387175 1:184021323-184021345 AGTTTCCAACACATGAACTTTGG - Intronic
918387272 1:184022338-184022360 AGTTTCCAACACATGAACTTTGG - Intronic
918611559 1:186498162-186498184 AGTTTCCAACACATGAAATTTGG + Intergenic
918879674 1:190100850-190100872 AGTTCCCAGCACATGAACTTTGG - Intronic
918929328 1:190833997-190834019 GGTTTGCAACACATGAACTTTGG - Intergenic
919159492 1:193809474-193809496 AGTTTCCAACACATAAACTTTGG - Intergenic
919482317 1:198105659-198105681 AGTTTCCAACACATTAACTTTGG - Intergenic
920041091 1:203097864-203097886 AGTTTCCAACACATGAACTTTGG + Intronic
920050070 1:203159025-203159047 AGTTTCCAACACATGAGCTTTGG + Intronic
920780537 1:208986912-208986934 AGTTTCCAACACATGAACTTTGG - Intergenic
920780547 1:208987056-208987078 AGTTTCCAACACATGAACTTTGG - Intergenic
921072952 1:211677107-211677129 AGTTTCCAACACATGAACTTTGG - Intergenic
921125069 1:212170353-212170375 AGTTTCCAACACATGAAATCTGG - Intergenic
921315977 1:213891300-213891322 TGTTTCAAACACATGAACTTTGG - Intergenic
921454382 1:215350242-215350264 AGTTTCCAACACATGAACTTTGG + Intergenic
921700909 1:218267482-218267504 AGTTTCCAACACATGAACTTTGG + Intergenic
921953571 1:220958661-220958683 AGTTTCTAACACATGAACTTTGG - Intergenic
922023435 1:221727902-221727924 AGTTTCCAATACATGAACTTTGG - Intronic
922203703 1:223428740-223428762 AGTTCCCAACACATGAACATTGG + Intergenic
922217091 1:223528655-223528677 AGTTTCCAACACATGAATTTGGG + Intergenic
922414183 1:225405368-225405390 CGTTTCCAACACGTGAACTTTGG - Intronic
923220249 1:231886202-231886224 GATTTCCAACACATTAACTTTGG + Intronic
923336424 1:232974889-232974911 AGTTTCCAACACATGAAATGTGG + Intronic
923501283 1:234567043-234567065 AGTTTCCAACACATAAACTTTGG - Intergenic
923755054 1:236784698-236784720 AGTTTCCAACACACGAACTTTGG + Intergenic
923880543 1:238099400-238099422 AGTTTCCAACACATGAATTTTGG + Intergenic
923949813 1:238936404-238936426 AGTTTACAACACATGAACTTTGG + Intergenic
924542420 1:244993915-244993937 AGTTTCCAACACACGAACTTTGG + Intronic
924549387 1:245061039-245061061 GGTTGCCAACTCCTGATCTATGG + Intronic
924939669 1:248804305-248804327 GGTTGCCAACTCCTGAGCTCAGG + Intergenic
1062868221 10:875804-875826 ATTTTCCAACACATGAACTTTGG + Intronic
1063265892 10:4450366-4450388 GGTTTCCACCACATGAATTCAGG + Intergenic
1063323733 10:5076229-5076251 AGTTTCCAACACATGGACTTTGG - Intronic
1063345937 10:5312478-5312500 AGTTTCCAACACATGAAATCTGG + Intergenic
1063473472 10:6307784-6307806 AGTTTCCAACACATGAACTTTGG - Intergenic
1063920323 10:10926179-10926201 GGTTTCCAGCACATGAATTGTGG - Intergenic
1064499578 10:15955311-15955333 AGTTTCCAACACATGAAATTTGG + Intergenic
1065051525 10:21797545-21797567 GGTTTCCAACAAATGAACTTTGG - Intronic
1065304619 10:24356531-24356553 AGTTTCTAACACATGAACTTTGG - Intronic
1065397673 10:25257333-25257355 CATTTCCAACACATGAACTTTGG + Intronic
1065605165 10:27411173-27411195 GTCTGCCAACCCAGGAACTAAGG - Intronic
1065743008 10:28813999-28814021 AATTTCCAACACATGAACTTTGG + Intergenic
1065835080 10:29649785-29649807 AGTTCCCAGCACATGAACTCTGG - Intronic
1065906828 10:30262407-30262429 AGTTTCCAACACATGGACTTCGG + Intergenic
1066629708 10:37447121-37447143 AGTTTCCAACACATAAACTTTGG - Intergenic
1066673397 10:37863022-37863044 AGTTTCCAACACATGAGCTTTGG - Intergenic
1066757086 10:38722101-38722123 AATTTCCAACACATGAACTTTGG + Intergenic
1067282944 10:44886706-44886728 AGTTTCCAACACATGAATTTTGG - Intergenic
1067358068 10:45549612-45549634 AGTTTCCAATACATGAACTTGGG - Intronic
1067913535 10:50371985-50372007 AGTTTCCAACACGTGAACTCTGG + Intronic
1068038577 10:51792746-51792768 GCCTGCCATCACATGAACTCTGG + Intronic
1068065031 10:52120249-52120271 AGCTGCCAACACATGAACTTTGG + Intronic
1068484258 10:57636327-57636349 AGTTTCCAACACATGGACTTTGG + Intergenic
1069155864 10:65030257-65030279 TGTTTCCAACACATAAACTTTGG - Intergenic
1069196486 10:65557038-65557060 AGTTTCTAACACATGAACTTTGG - Intergenic
1069297463 10:66864157-66864179 AGTTTCCAACACATGATCTTTGG - Intronic
1069344398 10:67450963-67450985 AGTTTCTAACACATGAACTTTGG - Intronic
1069632848 10:69907942-69907964 AGTTTCCAACACAAGAGCTATGG + Intronic
1070336501 10:75459968-75459990 AGTTTCCAATACATGAACTTTGG + Intronic
1071036237 10:81249424-81249446 AGTTTCCAACACACGAACTTTGG - Intergenic
1071036678 10:81255847-81255869 AGTTTCCAACACATGAATTTAGG + Intergenic
1071163849 10:82782132-82782154 AGTTACCAACACATGAATTTTGG - Intronic
1071359681 10:84833672-84833694 AGCTTCCAACACATGAACTTTGG - Intergenic
1071791298 10:88957041-88957063 AGTTCCCAACACATGAATTTTGG + Intronic
1071822739 10:89294596-89294618 AGTTTCCAACACATGAACTTTGG + Intronic
1072868774 10:99093758-99093780 AGTTTCCAACACATGAATTTTGG + Intronic
1073517682 10:104092068-104092090 AGTTTCCAACACATGAACTTTGG - Intergenic
1074009157 10:109458880-109458902 GTTTTCCAACACATGACCTCGGG + Intergenic
1074098932 10:110338144-110338166 AGTTTCCAACACATGAACTTTGG - Intergenic
1074590762 10:114810685-114810707 AGTTTGCAACACATGAACTTTGG + Intergenic
1075210220 10:120484680-120484702 GGGGACCAACACATGAACTTTGG + Intronic
1075291029 10:121231015-121231037 AGTTTCCAACCCATGAACTTTGG + Intergenic
1075350988 10:121725145-121725167 AGTTTCCAACACATGAATTTTGG + Intergenic
1075499926 10:122964199-122964221 TGTTTTCAACACATGAACTTTGG - Intronic
1075586680 10:123663600-123663622 GGTTTCCAACACATGAACTTTGG + Intergenic
1075620086 10:123920668-123920690 AGTTTCCAACACGTGAACTATGG - Intronic
1075970487 10:126647994-126648016 AGTTTCCAACACATGAATTTTGG - Intronic
1075984368 10:126770877-126770899 AGTTTCCAACACATGTACTTTGG - Intergenic
1075990346 10:126833071-126833093 ATTTTCCAACACATGAACTTTGG - Intergenic
1077673778 11:4180423-4180445 AGTTGCCAATACATGAACTTTGG - Intergenic
1078414283 11:11152664-11152686 AGTTTCCAACACATGAACTCTGG + Intergenic
1078433916 11:11309006-11309028 AGTTTTCAACACATGAACTTTGG - Intronic
1078732164 11:13984654-13984676 AGTTTCCAACACATAAACTTTGG + Intronic
1078756625 11:14216798-14216820 AGTTTCCAACACATGAATTTTGG + Intronic
1079065621 11:17288769-17288791 GGTTGCAAACCCCTGACCTATGG + Intronic
1079982212 11:27163183-27163205 AGTTTCCAACACATGAATTTTGG - Intergenic
1080053382 11:27880109-27880131 AGTTTCCAACACATGAACTTTGG - Intergenic
1081394501 11:42569631-42569653 AGTTTCCAACACATGAATTTTGG + Intergenic
1081983763 11:47286846-47286868 GGTTGCCACTGCATGAACTTAGG + Intronic
1082931624 11:58613429-58613451 AGTTTCCAACACATGAACTGTGG + Intronic
1083236580 11:61354785-61354807 GGCTGTCAACACAGGTACTAAGG + Intronic
1083544555 11:63538692-63538714 GGTGGCCAAGACAGGAACCAGGG + Intronic
1084616928 11:70242642-70242664 AGTTTCCAACACATGAACTTTGG + Intergenic
1085262715 11:75217192-75217214 AGTTTCTAACACATGAACTTTGG - Intergenic
1086488417 11:87333607-87333629 AGTTTCCAACACATGAACTTTGG - Intergenic
1086615937 11:88820043-88820065 AGTTTCCCACACATGAACTTTGG + Intronic
1086935582 11:92742493-92742515 TGTTTCCAACACATAAACTTTGG - Intronic
1087775523 11:102253310-102253332 AGTTTCCAACACGTGAACTCTGG + Intergenic
1088181516 11:107118040-107118062 AGTTTCCAACACATGAACTGTGG - Intergenic
1088566424 11:111177682-111177704 AGTTTCCAACACATGAAATCTGG + Intergenic
1088635929 11:111820584-111820606 AGTTCCCAATACATGAACTTTGG + Intronic
1088709408 11:112493761-112493783 AGTTTCCAACACAGGAACTTTGG + Intergenic
1088759555 11:112916233-112916255 AGTTTCCAACACATAAACTTTGG + Intergenic
1089107239 11:116023217-116023239 TGTTTCCAACACATGAACTTTGG - Intergenic
1090535430 11:127636197-127636219 AGTTACCAACACATGAATTTTGG - Intergenic
1090599214 11:128353076-128353098 ACTTTCAAACACATGAACTAAGG + Intergenic
1090903742 11:131055529-131055551 GGTTTCCAACACATAAATTTTGG + Intergenic
1092770586 12:11892839-11892861 GGGTGCAAACAGATGGACTATGG + Exonic
1092917701 12:13203226-13203248 GGTTGCCAAGATAATAACTAGGG - Intronic
1093037819 12:14350010-14350032 AGTTTCCAACACATGAAGTTTGG - Intergenic
1093538822 12:20255984-20256006 AGTTTCCAACACATAAACTTTGG + Intergenic
1093543544 12:20317681-20317703 AGTTCCCAACACATGAATTTTGG - Intergenic
1093934066 12:24982637-24982659 GGTTTCCAACATGTGAACTTAGG + Intergenic
1094060226 12:26306748-26306770 AGTTTCTAACACATGAACTTTGG + Intergenic
1094775521 12:33722766-33722788 TGTTTCCAACACATGAAATTTGG + Intergenic
1095136107 12:38605934-38605956 AGTTTCCAACACATGAACTTTGG + Intergenic
1095326150 12:40895671-40895693 TGTTTCCAACACATGAAATCTGG + Intronic
1095522316 12:43082192-43082214 AGTTCCCAATACATGAACTTTGG + Intergenic
1095529831 12:43173936-43173958 AGTTACCAACACATGAACTTTGG - Intergenic
1097299592 12:58004082-58004104 GGGGCCCAACACCTGAACTAGGG + Intergenic
1097443263 12:59637717-59637739 ACTTTCCAACACATGAACTTTGG - Intronic
1097721248 12:63023902-63023924 GGTTTCCAACACATGAACTGCGG - Intergenic
1097863319 12:64539395-64539417 AGTTTCCAACACATGAAATTTGG + Intergenic
1098115452 12:67171729-67171751 AGTTTCCAACACATGAACCTCGG - Intergenic
1098947218 12:76602173-76602195 AGTTTCCAACACATGAACTTTGG + Intergenic
1099263673 12:80416814-80416836 GACTGCTAAAACATGAACTAAGG - Intronic
1099810864 12:87580487-87580509 AGTTTCCAACACATGAACTTTGG + Intergenic
1099873342 12:88374965-88374987 AGTTTCCAACACGTGAACTTTGG + Intergenic
1099981195 12:89605279-89605301 TGTTTCCAACACATGAATTTGGG - Intronic
1100052596 12:90467779-90467801 AGTTTCTAACACATGAACTTTGG + Intergenic
1100957249 12:99922685-99922707 AGTTCCCAACACATGAACTTCGG - Intronic
1101103319 12:101416797-101416819 TGTTTCCAACACATGAACTTTGG - Intergenic
1101540511 12:105660698-105660720 AGTTTCCAACACATGAAATTTGG + Intergenic
1101721116 12:107351484-107351506 AGTTGCCAATACATGAACCTTGG - Intronic
1102437413 12:112936123-112936145 AGTTTCCAACACATGAATTCTGG + Intergenic
1103227243 12:119298547-119298569 AGTTTCTAACACATGAACTTTGG - Intergenic
1105530050 13:21211005-21211027 AGTTTCCAACACATGACCTTTGG + Intergenic
1105607162 13:21935558-21935580 AGTTTCAAACACATGAACTTTGG - Intergenic
1105933466 13:25074941-25074963 AGTTTCCAACGCATGAACTGTGG + Intergenic
1106738462 13:32612575-32612597 AGTTCCCAACACATGAACTTTGG - Intronic
1106872967 13:34041925-34041947 AGTTTCCAACACATGAAATTTGG - Intergenic
1107252376 13:38379652-38379674 GGATTCCAACACATGAATTTTGG + Intergenic
1107270592 13:38611191-38611213 AGTTTCCAACACCTGAACTTTGG + Intergenic
1107344357 13:39443020-39443042 AGTTTGCAACACATGAACTTTGG - Intronic
1107523471 13:41206082-41206104 GGTTTCCAACACATGAAATTTGG - Intergenic
1107610218 13:42105425-42105447 AGTTTTCAACACATGAACTGTGG + Intronic
1107752008 13:43577700-43577722 GGTTTCCAACACATGAATTTTGG + Intronic
1107766790 13:43744072-43744094 GGCTTCCAACACATGATCTTTGG + Intronic
1108005605 13:45942879-45942901 AGTTTCCAACACATGAACTTTGG - Intergenic
1108269392 13:48744360-48744382 AATTCCCAACACATGAACTTTGG - Intergenic
1108386631 13:49905073-49905095 AGTTTCCAGCACATGAACTGTGG - Intergenic
1108582035 13:51836059-51836081 AGTTTCCAACACATGAACTTTGG - Intergenic
1108598850 13:51973349-51973371 TGTTTCCAACACATGAAATTTGG - Intronic
1109869541 13:68315562-68315584 AGTTTCCAATACATGAACTTTGG + Intergenic
1110076833 13:71256437-71256459 AGTTTCCAACACATGAATTTTGG + Intergenic
1110439936 13:75516656-75516678 AGTTTCCAACACATGAACTTTGG - Intergenic
1110626070 13:77657589-77657611 GGTTTTCAACATATGAACTTTGG + Intergenic
1110674141 13:78219896-78219918 AGTTTCCAACACGTGAACTTTGG - Intergenic
1110994171 13:82084330-82084352 AGTTTCCAACAAATGAACTTTGG + Intergenic
1111248072 13:85568270-85568292 AGTTTCCAACACATGAAATTTGG + Intergenic
1111277155 13:85965359-85965381 GGTGGCCAACTCCTGAACTCAGG - Intergenic
1111773967 13:92635629-92635651 AGTTTCTAACACATGAACTTTGG + Intronic
1113173983 13:107539467-107539489 GATTTCCAACACATGAATTTGGG + Intronic
1114857478 14:26466661-26466683 AGTTTCCAACACATGAATTTTGG - Intronic
1115012403 14:28565219-28565241 AGTTCCCAACACATGAACTATGG - Intergenic
1115121204 14:29940441-29940463 AGTTTCCAACACATGAAATTTGG + Intronic
1116054992 14:39852606-39852628 AATTTCCAACACATGAACTTTGG + Intergenic
1116439995 14:44940289-44940311 AGTTTCCAACACATGAATTTTGG + Intronic
1116729227 14:48601264-48601286 AGTTTTCAACACATGAACTTTGG - Intergenic
1117202495 14:53406614-53406636 AGTTTCCAACACATGAACTTTGG - Intergenic
1117305813 14:54472058-54472080 AGTTTCCAACACATGAATTTTGG - Intergenic
1117435501 14:55712082-55712104 AGTTTCCAACACATGAACTTCGG - Intergenic
1117833280 14:59776197-59776219 AGTTTCCAACACATGAACTTTGG - Intronic
1118033292 14:61839141-61839163 CGTTTCCAACACATGAATTTTGG - Intergenic
1118340279 14:64890044-64890066 AGTCTCCAACACATGAACTTTGG + Intergenic
1118825335 14:69375036-69375058 AGTTTCCAACACATAAACTTTGG + Intergenic
1119128145 14:72147591-72147613 GGTTTCCAGCACATAAACTTTGG + Intronic
1119529099 14:75347053-75347075 AGTTTCCAACACATGAGCTTTGG - Intergenic
1119533173 14:75377847-75377869 AGTTTCCAACACATAAACTCTGG - Intergenic
1120314722 14:82876440-82876462 AGTTTTCAACACATGAACTTTGG - Intergenic
1120502786 14:85317732-85317754 AGTTGCTAACATATGAACTTTGG + Intergenic
1120508986 14:85389668-85389690 AGTTTCCAACACCTGAACTTTGG + Intergenic
1120707972 14:87763970-87763992 GGTTTCTAACACATGACCTTTGG + Intergenic
1120932367 14:89861603-89861625 AGTTTCCAACACATGAAATTTGG - Intronic
1121234516 14:92382684-92382706 GGTGGCCAAGGCATGACCTACGG - Intronic
1121421094 14:93815021-93815043 AGTTTCCAAGACATGAACTTTGG + Intergenic
1121616206 14:95315362-95315384 GCTTCCCAACCCATGAGCTAAGG - Intronic
1122001724 14:98662758-98662780 AGTTTCCAACACATGAACTTTGG + Intergenic
1124347644 15:28933206-28933228 GGTTTCCAACACATGAACTTTGG + Intronic
1124508873 15:30305391-30305413 AGTTTCCAACACATGAACTTTGG + Intergenic
1124591363 15:31056584-31056606 AGTTTCCAACACAAGAACTTTGG - Intronic
1124734685 15:32233271-32233293 AGTTTCCAACACATGAACTTTGG - Intergenic
1124936722 15:34179446-34179468 AGTTTCCAACACGTGAACTCTGG + Intronic
1125255046 15:37753575-37753597 AGTTTCCAACACATGAACTTTGG + Intergenic
1125753651 15:42047551-42047573 AGTTTCCAACACATGACCTTTGG + Intronic
1126423544 15:48501166-48501188 AGTTTCCAGCACATGAACTTTGG - Intronic
1126656331 15:50981657-50981679 TGTTTCCAACACATGAACTTTGG - Intronic
1126782867 15:52153312-52153334 GGTTGCCGACAGCTGGACTAAGG - Intronic
1126846357 15:52764330-52764352 TGTTTCCAACACATGAAATTTGG + Intronic
1127224466 15:56915909-56915931 AGTTGTCAACACATGAACTTTGG - Intronic
1127314833 15:57785149-57785171 GTTTGCCAACCCCTGGACTAGGG - Intergenic
1127344755 15:58083280-58083302 GGATTTCAACACATGAACTAAGG + Intronic
1127466408 15:59248768-59248790 AGATGTGAACACATGAACTAAGG - Intronic
1127519892 15:59733457-59733479 AGTTGCCAACACGTAAACTGTGG - Intergenic
1127893155 15:63272544-63272566 GGTTGCGAACTCATGAGCTCAGG + Intergenic
1128564083 15:68687960-68687982 AGTTTCCAACACATGAACTCTGG + Intronic
1129786007 15:78310606-78310628 AGTTTCCAACACACGAACTTTGG + Intergenic
1130017054 15:80195749-80195771 AGTTTCCAACATATGAACTTTGG + Intergenic
1130951415 15:88592817-88592839 GTTTGCCAATACATGAACATGGG + Intergenic
1131518865 15:93098542-93098564 AGTTTCCAACACATGAACTTTGG + Intergenic
1131662916 15:94537901-94537923 AGTTTCCACCACATGAACTTTGG - Intergenic
1131769626 15:95721830-95721852 AGATTCCAACACATGAACTTTGG + Intergenic
1131861998 15:96663659-96663681 AGTTTCCAACACATGAACTTTGG - Intergenic
1133003488 16:2863855-2863877 AGTTTCCAACACATGAACTTTGG - Intergenic
1133667207 16:7980220-7980242 GGTTGCAAACACATAAATCATGG - Intergenic
1133852185 16:9515954-9515976 AGTTTCCAACACATGAACTTTGG + Intergenic
1134038518 16:11050306-11050328 AGTTTCCAACACATGAACTATGG + Intronic
1135072910 16:19368045-19368067 AGTTGCCAACACATGAACTTTGG + Intergenic
1135346656 16:21694538-21694560 GTTTGCCAACTCTTGGACTAAGG + Intronic
1135387611 16:22057479-22057501 TGTTTCCAACACATGAATTTTGG + Intronic
1135650316 16:24200831-24200853 AGTTTCTAACACATGAACTTTGG + Intronic
1135754295 16:25083652-25083674 AGTTTCCAACACATGAACTTTGG - Intergenic
1136627257 16:31469388-31469410 AGTTTCCAACACATGAACTCTGG - Intergenic
1136651539 16:31677389-31677411 GGATTCCAAGACATGAACTGGGG + Intergenic
1136720435 16:32315632-32315654 AATTTCCAACACATGAACTTTGG - Intergenic
1136725490 16:32354023-32354045 AATTTCCAACACATGAACTTTGG - Intergenic
1136838812 16:33521906-33521928 AATTTCCAACACATGAACTTTGG - Intergenic
1136843819 16:33560079-33560101 AATTTCCAACACATGAACTTTGG - Intergenic
1138880106 16:61002932-61002954 ATTTGCAAACACATGAGCTAAGG - Intergenic
1139052149 16:63137679-63137701 TGTTTCGAACACATGAACTTGGG - Intergenic
1140391717 16:74592850-74592872 AGTTTCCAACACATGAACTTTGG - Intronic
1203000942 16_KI270728v1_random:163733-163755 AATTTCCAACACATGAACTTTGG + Intergenic
1203005997 16_KI270728v1_random:202137-202159 AATTTCCAACACATGAACTTTGG + Intergenic
1203132543 16_KI270728v1_random:1700136-1700158 AATTTCCAACACATGAACTTTGG + Intergenic
1203148977 16_KI270728v1_random:1822194-1822216 AATTTCCAACACATGAACTTTGG - Intergenic
1203153984 16_KI270728v1_random:1860377-1860399 AATTTCCAACACATGAACTTTGG - Intergenic
1142541747 17:665041-665063 TGTTTCCAACACATGAACTTTGG - Intronic
1143370998 17:6439410-6439432 GGTTTCCAACAGATGAAATTTGG + Intergenic
1143942998 17:10562363-10562385 AGTTTCCAATACATGAACTTTGG - Intergenic
1144244034 17:13345599-13345621 AGTTTCCAACACATGAATTTTGG + Intergenic
1144647462 17:16985143-16985165 GGTTTCCAACACATGAATTTTGG - Intergenic
1144939413 17:18927284-18927306 AGTTTCCAACACATGAATTTTGG + Intronic
1145030068 17:19498184-19498206 AGTTTCCAACACATGAAATTTGG - Intronic
1145365589 17:22263787-22263809 GGTTGCAAACACTTTAACTGTGG - Intergenic
1145727425 17:27144028-27144050 AGTTTCCAACACATGAAATTTGG - Intergenic
1146529981 17:33600196-33600218 CGTTTCCAACACATCAACTTTGG - Intronic
1146672639 17:34752342-34752364 AGTTTCTAACACATGAACTTTGG + Intergenic
1146730148 17:35186228-35186250 CATTTCCAACACATGAACTCTGG + Intronic
1147584350 17:41645159-41645181 CGTTTCCAAAACATGAACTTTGG - Intergenic
1147985597 17:44305877-44305899 AGTTTCCAACACATGAACTTCGG + Intergenic
1149965948 17:61164297-61164319 CATTTCCAACACATGAACTTTGG - Intronic
1150686875 17:67327966-67327988 AGTTTCCAACACATGAACTTTGG - Intergenic
1150909626 17:69374559-69374581 GGTTTCAAACTCCTGAACTAAGG + Intergenic
1151835395 17:76579571-76579593 AGTTTCCAACACATAAACTTTGG - Intronic
1152010697 17:77712076-77712098 AGTTTCCAACACATGAAATTTGG - Intergenic
1153263276 18:3244672-3244694 GGTTGCCAACTCCTGACCTCAGG - Intergenic
1153268210 18:3292939-3292961 AGTTTACAACACATGAACTTTGG + Intergenic
1153571100 18:6474627-6474649 GGTTACAAAGACATGAACAAGGG - Intergenic
1156148302 18:34213184-34213206 AGTTTCCAACACAGGAACTTCGG - Intronic
1156386333 18:36608483-36608505 AGTTTCCAACACATGAACTTTGG + Intronic
1157820741 18:50766662-50766684 AGTTTCCAACACATGAATTTTGG - Intergenic
1158034197 18:53004871-53004893 AGTTTCCAACATATGAACTTTGG - Intronic
1158152523 18:54388580-54388602 AGTTTCCAACACATGAATTTAGG + Intergenic
1158367843 18:56759335-56759357 GAATCACAACACATGAACTATGG - Intronic
1158490938 18:57909272-57909294 AGTTGCCAACACATGAATTTAGG - Intergenic
1158618624 18:59010801-59010823 AGTTTCCAACACATGAATTTTGG + Intergenic
1158701426 18:59751632-59751654 GGTTGACAAAATATGACCTATGG - Intergenic
1158992039 18:62879114-62879136 TGTTTCCAACACATCAACTTTGG - Intronic
1159270286 18:66140379-66140401 TGTTTCCAACACATGAACTTTGG + Intergenic
1159814996 18:73062427-73062449 GGTTTCAAACTCATGAACTCAGG - Intergenic
1159820108 18:73130835-73130857 AGTTTCCAACACATGAAATTGGG - Intergenic
1159942788 18:74421323-74421345 AGTTTCCAACACATGAACTTTGG - Intergenic
1160037335 18:75314167-75314189 AGTTTCCAACACATGAACTTTGG - Intergenic
1160450664 18:78963930-78963952 AGTTTTCAACACATGAACTTGGG + Intergenic
1161014001 19:1974466-1974488 GGTTCCCAACACATGACCCTTGG + Intronic
1161178394 19:2862562-2862584 GGCTGCAGACACAGGAACTAGGG - Intergenic
1164500366 19:28814580-28814602 AGTTTCCAGCACATGAACTTTGG + Intergenic
1164958645 19:32407446-32407468 GGTTGTCAACACATTTACTATGG + Intronic
1165323383 19:35099881-35099903 GGTTGCTACCCCATGCACTACGG + Intergenic
1165521376 19:36316876-36316898 AGTTTCCAACACATGAACTTTGG + Intergenic
1165622685 19:37261713-37261735 AGTTTCCAACACATGAACTTCGG - Intergenic
1165634389 19:37328347-37328369 AGTTTCCAACACATGAACTTTGG - Intronic
1165994621 19:39834941-39834963 CGTTTCCAACACATGAACTTTGG - Intronic
1166051163 19:40261119-40261141 AGTTTCCAACACATGAACTTTGG - Intronic
1166697302 19:44859433-44859455 GGATTCAAACCCATGAACTATGG + Intronic
1166848410 19:45744933-45744955 GGATGTTAACACATGGACTAGGG + Intronic
1167013521 19:46824541-46824563 GGTTGCAAACACATGGCCTGAGG + Intergenic
925258712 2:2511492-2511514 GGTTTCCAACACATCAACTTTGG - Intergenic
925568887 2:5287946-5287968 AGTTCCCCACACATGAACTGTGG + Intergenic
926283779 2:11471438-11471460 AGTTTCCAACACATGAATTCTGG + Intergenic
926442328 2:12902837-12902859 AGTTTCCAACACATGAAATTTGG + Intergenic
926655840 2:15404727-15404749 GGTTTCCAACTCTTGACCTAAGG + Intronic
927196826 2:20553576-20553598 TTTTTCCAACACATGAACTTTGG + Intergenic
927828572 2:26327960-26327982 AGTTTCCAACACATGAACTTTGG + Intronic
928631079 2:33193011-33193033 AGTTTCTAACACATGAACTTTGG + Intronic
928822609 2:35380155-35380177 AGTTTCCAACATATGAACTTTGG - Intergenic
928844923 2:35659776-35659798 AGTTTCCAACACATGAATTTTGG + Intergenic
929027954 2:37623419-37623441 AGTTTCCAACACATGAAATCTGG - Intergenic
930032516 2:47067159-47067181 AGTTGCTAACACATGAATTTTGG + Intronic
930259318 2:49126499-49126521 AGTTTCCAACACATAAACTTTGG + Intronic
930361844 2:50390565-50390587 AGTTTCTAACACATGAACTTTGG - Intronic
930488070 2:52033950-52033972 AGTTTCTAACACATGAACTTTGG - Intergenic
930674691 2:54187798-54187820 AGTTTCCAACACATGAATTCTGG - Intronic
930876346 2:56222118-56222140 AGTTCCCAACACATGAACTATGG + Intronic
931381074 2:61753921-61753943 AGTTTCCAGCACATGAACTTTGG + Intergenic
931396969 2:61896188-61896210 AGTTTCCAACACATGAATTTTGG - Intronic
931439969 2:62282387-62282409 AGTTTCTAACACATGAACTTTGG - Intergenic
931861534 2:66359845-66359867 AGTTTCCAACACATGAACTCTGG - Intergenic
932061363 2:68502213-68502235 AGTTTCCAACACATGGACTTTGG + Intronic
932224435 2:70028571-70028593 AGTTTCCAACACATGAACTTTGG - Intergenic
932562209 2:72883079-72883101 AATTTCCAACACATGAACTTTGG + Intergenic
932660068 2:73644025-73644047 GGTTGCCAAGCCATGAGCCATGG + Intergenic
932683581 2:73848750-73848772 AGTTTCCAAAACATGAACTTTGG + Intronic
933223769 2:79721496-79721518 TGTTTCCAACACATGAAATGTGG + Intronic
933598047 2:84302494-84302516 CGTTTCCAACACATGAACTTTGG + Intergenic
933795272 2:85914559-85914581 AGTTTCCAACATATGAACTTTGG + Intergenic
933939473 2:87233443-87233465 GGTTTCCAACACACGAACTTTGG - Intergenic
934320395 2:91966541-91966563 AATTTCCAACACATGAACTTTGG + Intergenic
934623349 2:95829842-95829864 AGTTGCCAAAACATCAAATATGG + Intergenic
934810407 2:97272249-97272271 AGTTGCCAAAACATCAAATATGG - Intergenic
934827285 2:97435690-97435712 AGTTGCCAAAACATCAAATATGG + Intergenic
934912425 2:98271877-98271899 AGTTTCCAACACATGAACTCTGG - Intronic
935517317 2:104056815-104056837 AGTTTCCAACATATGAACTTTGG + Intergenic
935635350 2:105245597-105245619 AGTTTCCAACACATGAGCTTTGG + Intergenic
935740679 2:106144870-106144892 GGATGCCAACATATGAATTTGGG + Intronic
936353662 2:111732330-111732352 GGTTTCCAACACACGAACTTTGG + Intergenic
936752228 2:115658952-115658974 AGTTTCCAACACATAAACTTTGG - Intronic
937649355 2:124302692-124302714 GGTTTCCAACATGTGAACTTTGG + Intronic
937894413 2:126967756-126967778 GGTTGCCAACAAAGGAAGGATGG - Intergenic
938089273 2:128420487-128420509 AGTTTCCAGCACATGAACTGTGG - Intergenic
938736508 2:134191279-134191301 TGTTTCCAACACATGAACTTTGG - Intronic
939146410 2:138420480-138420502 TGTTTCCAATACATGAACTTTGG - Intergenic
940890213 2:159028069-159028091 CGTTGCCAACACATGAAAGTTGG + Intronic
942173791 2:173311769-173311791 AGTTTCCAACACATGAACTTTGG + Intergenic
942198975 2:173552028-173552050 AGTTTCCAACACATGAAATCTGG + Intergenic
942211917 2:173679821-173679843 CGTTTTCAACACATGAACTTTGG - Intergenic
942483162 2:176411276-176411298 AGTTTCCAACACATGAACTTTGG + Intergenic
942550138 2:177107257-177107279 AGTTTCCAACACGTGAACTTTGG - Intergenic
942664683 2:178304689-178304711 GGTTTCTAACACATGAATTTTGG + Intronic
942928781 2:181464211-181464233 GGTTGCCAAGACATCAACCAGGG + Intronic
943024904 2:182615970-182615992 AGTTTCCAACACATTAACTTTGG + Intergenic
943330180 2:186549627-186549649 AGTTTCCAACACATAAACTTTGG + Intergenic
944430657 2:199630050-199630072 AGTTTCCAACACATGAACTTTGG - Intergenic
945084248 2:206115297-206115319 AGTTTCCAACACATGAATTGTGG - Intronic
945390072 2:209254706-209254728 AGTTTCCAACACATGAATTTTGG - Intergenic
945964648 2:216173625-216173647 AGTTTCCAACACATAAACTTTGG - Intronic
945972496 2:216244160-216244182 AGTTTGCAACACATGAACTTTGG + Intergenic
946500352 2:220240704-220240726 AGTTTCCAACACATGTACTTTGG + Intergenic
946582790 2:221148603-221148625 TGTTTCCAACACATTAACTTTGG - Intergenic
947036454 2:225863654-225863676 AGTTTCCAACACATGAACTTTGG - Intergenic
947487403 2:230564837-230564859 AGTTTCCAACACGTGAACTTTGG - Intergenic
947540624 2:230975086-230975108 AGTTTCCAACACATGAACTTTGG + Intergenic
947866990 2:233405163-233405185 AGTTTCCAACACATGAACTTTGG - Intronic
947966360 2:234284916-234284938 AGTTGCCAACACACGAACTTTGG - Intergenic
948666593 2:239538612-239538634 GGTTTCCAAGACTTGGACTAAGG - Intergenic
1170794650 20:19536065-19536087 AGTTTCCAACGCATGAACTTTGG + Intronic
1170817198 20:19723868-19723890 GATTGCCAACCCAGGAACTGTGG + Intergenic
1173270270 20:41527755-41527777 GGTTTCCAACACAGGAATTTTGG - Intronic
1173601954 20:44301709-44301731 AGTTTCCAAGACATGAACTTTGG + Intergenic
1173912688 20:46681996-46682018 AGTTTCCAACACATGAAATACGG + Intronic
1174198266 20:48788680-48788702 TGTTTCCAACACATGAAATGTGG - Intronic
1175086637 20:56464983-56465005 GATTTCCAACACATGAAATTTGG + Intergenic
1176158480 20:63635963-63635985 AGTTTCCAACACGTGAACTTCGG + Intergenic
1176965271 21:15205617-15205639 GGTTTCCAACATATGAATTTGGG - Intergenic
1176991920 21:15507584-15507606 GGTTTCCAACACATGGATTTTGG - Intergenic
1177282310 21:18997428-18997450 AGTTTCCAATACATGAACTTTGG - Intergenic
1177324670 21:19568947-19568969 AGTTTCCAACACATGAACTTTGG + Intergenic
1177803704 21:25853522-25853544 CGTTTTCAACACATGAACTTTGG + Intergenic
1177946641 21:27478992-27479014 TGTTTCCAACACATGAATTTCGG + Intergenic
1177985343 21:27967755-27967777 AGTTTCTAACACATGAATTATGG + Intergenic
1178135848 21:29626375-29626397 AGTTTCCAACACATGAACTCTGG + Intronic
1178458511 21:32778982-32779004 AGTTTCCAACACATGAATTTTGG - Intergenic
1178903208 21:36614283-36614305 TGTTTCCAACACATGAACTTGGG - Intergenic
1178940824 21:36903802-36903824 TGTTTCCAACACATGAAATTTGG - Intronic
1179163985 21:38920823-38920845 GGCTGCAAACAGATGAGCTAGGG + Intergenic
1179239335 21:39575163-39575185 GGATTTCAACACATGAACTTTGG + Intronic
1179381072 21:40899682-40899704 CGTTTCCAACACATGAATTGTGG + Intergenic
1180308639 22:11150597-11150619 AATTTCCAACACATGAACTTTGG + Intergenic
1180547116 22:16512408-16512430 AATTTCCAACACATGAACTTTGG + Intergenic
1181004725 22:20007519-20007541 AGTTTCCAACACGTGAACTTTGG - Intronic
1182418523 22:30236871-30236893 GGTTTCCAACACATGAAATTTGG + Intergenic
1182817549 22:33179174-33179196 AGTTTCCAACACATGAAATTTGG + Intronic
1183729847 22:39612014-39612036 GGTTGCCAACACATGAACTATGG - Intronic
1183973101 22:41493242-41493264 AGTTGCCAACACATAAACTTTGG + Intronic
1184007290 22:41719647-41719669 AGTTTCCAACACATGAACTTTGG + Intronic
949224762 3:1681209-1681231 AGTTTCCAACAAATGAACTTTGG + Intergenic
949965907 3:9356071-9356093 AGTTTCAAACACATGAACTTTGG + Intronic
950319217 3:12034781-12034803 AGTTTCCAACACATGAATTTTGG + Intronic
950704407 3:14771026-14771048 GGATTTCAACACATGAACTTTGG - Intronic
951272745 3:20647168-20647190 AGTTTCAAACACATGAACTCTGG - Intergenic
951284573 3:20793557-20793579 AGCTTCCAACACATGAACTTTGG + Intergenic
952487562 3:33830080-33830102 GATTGGGAACACATGAACTTTGG + Intronic
953144386 3:40261056-40261078 AGTTTCTAACACATGAACTTTGG + Intergenic
953731211 3:45449606-45449628 AGTTTCCAACACATGAACTTTGG + Intronic
953753254 3:45625557-45625579 AGTTTCCAACACTTGAACTGTGG - Intronic
953898868 3:46826889-46826911 AGTTTCCAACACATGAACTTTGG - Intergenic
954934954 3:54317987-54318009 AGTTTCCAATACATGAACTTTGG + Intronic
954956376 3:54522861-54522883 AGTTTCTAACACATGAACTTTGG + Intronic
955301577 3:57784745-57784767 AGTTTCCAACACATGAACCATGG - Intronic
955636681 3:61037547-61037569 AGTTTCCAACACATGGACTTTGG - Intronic
955691685 3:61597234-61597256 GGTTTCCAGCACATGACCTTTGG + Intronic
955944727 3:64182093-64182115 AGTTTCCAACACATGAATTTGGG - Intronic
956334824 3:68151766-68151788 AGTTTCCATCACATGAACTTTGG + Intronic
956765475 3:72480982-72481004 AGTTTCCAACACATGAATTTTGG - Intergenic
956820718 3:72951575-72951597 GGCTGCCAAGACTTGAACTCAGG + Intronic
957122583 3:76114196-76114218 AGTTTCCAACACATGAACTTTGG + Intronic
957218915 3:77357178-77357200 AGTTTCCATCACATGAACTTTGG - Intronic
957813878 3:85265655-85265677 AATTCCCAACACATGAACTTTGG + Intronic
957835100 3:85577239-85577261 AGCTTCCAACACATGAACTCCGG - Intronic
957891276 3:86362397-86362419 AGTTTCCAACACATGAAATCTGG + Intergenic
957992468 3:87644775-87644797 GGTTCCCAACACCTGGACTGTGG + Intergenic
958555605 3:95672684-95672706 AGTTTCCACCACATGAACTTTGG + Intergenic
959240407 3:103784754-103784776 GATTTCCAACATATGAACTTTGG + Intergenic
959418831 3:106109519-106109541 GGTTTCCAACATATGAATTTGGG - Intergenic
959633860 3:108539102-108539124 AGTTTCCTACACATGAACTTTGG + Intergenic
959798558 3:110462454-110462476 AGTTTCCAACACATGAATTTTGG + Intergenic
960146267 3:114207118-114207140 AGTTTCTAACACATGAACTTTGG + Intergenic
960593143 3:119384740-119384762 AGTTCCCAACACATGAACTTTGG + Intronic
960645469 3:119876665-119876687 AGTTTCCAACACATGAGCTTTGG - Intronic
960772091 3:121205501-121205523 AGTTTCCAACACATGAATTTTGG + Intronic
961314075 3:126022639-126022661 AGTTTCCAACACATGAAATGTGG + Intronic
961739590 3:129024814-129024836 GGTTTCCAACACGTGAACTTTGG + Intronic
962004116 3:131331083-131331105 AGTTTCCAACACATGAACCTTGG + Intronic
962067570 3:131998031-131998053 AGTTTCCAACACATGAACTTTGG + Intronic
962177493 3:133169219-133169241 AGTTTCCAACAAATGAACTTTGG + Intronic
962803051 3:138906601-138906623 AGTTTCCAACACATGAACTTCGG + Intergenic
963526024 3:146414260-146414282 AGTTTCCAGCACATGAACTTTGG + Intronic
964039602 3:152243438-152243460 TGTTACTTACACATGAACTATGG - Intergenic
965959086 3:174407379-174407401 AGTTTCCAACACATGAAATTTGG + Intergenic
966029422 3:175326884-175326906 AGTTTCCAACACATGAGCTGTGG + Intronic
966090655 3:176131630-176131652 AGTTGCCAGCAAATGAAGTAAGG - Intergenic
966288768 3:178329735-178329757 AGTTTCCAACACATGAATTTTGG + Intergenic
966555634 3:181257375-181257397 AGTTTCCAACACATAAACTTTGG + Intergenic
966762718 3:183431449-183431471 AGTTTCCAACACATGAACTTTGG - Intergenic
968205822 3:196799383-196799405 AGTTTCTAACACATGAACTCTGG - Intronic
968624703 4:1621866-1621888 GGTTTCCAACACATGAGCCTTGG - Intronic
968733254 4:2281676-2281698 AGTTACCAACACATGAACTTTGG + Intronic
968840313 4:2999429-2999451 AGCTACCAACACATGAACTTTGG + Intronic
969093350 4:4713369-4713391 GGATTTCAACACATGAACTTTGG + Intergenic
969147197 4:5134224-5134246 AGTTTCCAACACATAAACTTTGG - Intronic
969630300 4:8332111-8332133 GGGTGTCAACACGTGAACTCTGG - Intergenic
970261477 4:14229534-14229556 AGTTTTCAACACATGAACTTTGG + Intergenic
971193886 4:24453561-24453583 GGTTGCCAACTCCTGACCTCAGG - Intergenic
971194112 4:24455574-24455596 AGTTTCCAACACTTGAACTTTGG - Intergenic
971302760 4:25455656-25455678 AGTTTCCAACACATGAACTTTGG + Intergenic
972566588 4:40274987-40275009 AGTTTCCAACACATGAGCTTTGG + Intergenic
972668172 4:41188369-41188391 GGATTCCAACACATGAATTTTGG - Intronic
972851319 4:43053973-43053995 AGTTTCTAACACATGAACTTTGG - Intergenic
973738246 4:53893631-53893653 AGTTCCCAACATATGAACTTTGG + Intronic
974024543 4:56721851-56721873 AGTTTCCAGCACATGAACTTTGG - Intergenic
974095799 4:57362452-57362474 AGTTTCCAACACATGAATTTTGG + Intergenic
974115379 4:57572344-57572366 AGTTTCTAACACATGAACTTTGG + Intergenic
974355908 4:60812481-60812503 AGTTTCCAACACATGAACTTTGG + Intergenic
974438810 4:61890706-61890728 AGTTTCTAACACATGAACTTTGG + Intronic
974514155 4:62886629-62886651 AGTTTCCAACACATGAACTTTGG - Intergenic
975064558 4:70044379-70044401 GATTGCCAGCACATGTAATATGG - Intergenic
975859887 4:78665610-78665632 AGTTTCCAACACATGAACTTTGG - Intergenic
976153936 4:82122353-82122375 TGTTCCCAACACATGAACTTCGG + Intergenic
976224094 4:82781548-82781570 AGTTTCCAACACATGAACTTAGG - Intronic
976261064 4:83145257-83145279 GGCGGTCAATACATGAACTATGG + Intergenic
976376345 4:84349939-84349961 AGTTTCCAACACATGAAATTTGG + Intergenic
976446489 4:85135846-85135868 AGTTTCCAACACATGAGCTTTGG + Intergenic
976539866 4:86262089-86262111 AGTTTCCAACACAGGAACTTTGG - Intronic
976633002 4:87258759-87258781 AGTTTCCAACACATGAACTTTGG - Intergenic
976841204 4:89434039-89434061 AGTTTCCAATACATGAACTTTGG - Intergenic
976953465 4:90864316-90864338 TGTTTCCAACACATGAACTTTGG - Intronic
977073051 4:92417368-92417390 AGTTTCCAACACATGAATTTTGG - Intronic
977192725 4:94021013-94021035 AGTTTCCAACACATAAACTTTGG - Intergenic
977320103 4:95503068-95503090 AGTTTCCAACACATGAATTTTGG - Intronic
977421391 4:96804553-96804575 AGTCTCCAACACATGAACTTTGG - Intergenic
977903918 4:102454660-102454682 AGTTTCCAACACATGAAATCTGG + Intergenic
977983647 4:103356912-103356934 AGTTCCCAACACATGAACTTTGG + Intergenic
978330245 4:107604628-107604650 AGTTTCCAACACATGAACTTTGG + Intronic
978524592 4:109652726-109652748 GGTTTCCAACACATGGACTCTGG + Intronic
978526773 4:109675629-109675651 AGTTTCCAACACATCAACTTTGG - Intronic
978535242 4:109755423-109755445 AGTTTCCAACACATGAACTTTGG - Intronic
978723463 4:111942260-111942282 AGTTTCCAACACATGAACTTTGG + Intergenic
978945147 4:114486397-114486419 GTTTGCCAACCCTTGATCTAGGG - Intergenic
979415968 4:120439280-120439302 AGTTTCCAACACATGAATTTGGG - Intergenic
979593417 4:122506234-122506256 AGTGTCCAACACATGAATTATGG + Intergenic
979791252 4:124784224-124784246 AGTTTCTAACACATGAACTTTGG - Intergenic
979848920 4:125552395-125552417 CGTTTCCAACACATGACCTTTGG + Intergenic
980049437 4:128024387-128024409 AGTTTCCAACACATGAACTTTGG + Intronic
980237481 4:130128231-130128253 AGTTTCCAACACATGAAATTTGG - Intergenic
980311257 4:131132522-131132544 GGTTTCCAACACATAAATTTTGG - Intergenic
981032139 4:140136179-140136201 GGGTCTCTACACATGAACTAGGG - Intronic
981530044 4:145743565-145743587 AGTTTTCAACACATGAACTTTGG + Intronic
981621392 4:146703606-146703628 AGTTTCCAACACGTGAACTTTGG + Intergenic
981796978 4:148606338-148606360 AGTTCCCAACACATGAACTTTGG - Intergenic
981916255 4:150036650-150036672 GTTTGTTAACACATGAACAAGGG + Intergenic
981961854 4:150550950-150550972 AGTTTCCAACACATGAACTTTGG - Intronic
982037454 4:151360081-151360103 GGTTGCCACCAACTGAAATAGGG + Intergenic
982086207 4:151839350-151839372 AGTTTCCAACACATGAATTGTGG - Intergenic
982286957 4:153745907-153745929 TGTTTCCAACACATGAACTTTGG + Intronic
982743178 4:159079192-159079214 GGATGTCAACACATGAATTTTGG - Intergenic
982787306 4:159550697-159550719 AGTTTCCAACACATGAACTTTGG + Intergenic
982977094 4:162077360-162077382 AGTTTCCAACACATAAACTTTGG + Intronic
982994238 4:162320297-162320319 AGTTTCCAACACATGAACTTTGG + Intergenic
983021582 4:162683249-162683271 AGTTTCCAACACATGAACTTTGG + Intergenic
983283926 4:165715556-165715578 AGTTTCCAACACATGAATTTTGG - Intergenic
983884883 4:172969738-172969760 CGTTTCCAACACATGAACTTTGG - Intronic
984103496 4:175515785-175515807 AGTTTCCAACACATCAACTTTGG - Intergenic
984109594 4:175595935-175595957 GGTTTCCTACACATGAAATATGG - Intergenic
984273134 4:177572785-177572807 AGTTTACAACACATGAACTTTGG + Intergenic
984309498 4:178038694-178038716 AGTTTCCAACACATGAACTTTGG + Intergenic
984389343 4:179109214-179109236 AATTTCCAACACATGAACTTTGG - Intergenic
985073063 4:186187493-186187515 AGTTTCCAACACATGAACTTTGG - Intergenic
986423774 5:7610270-7610292 GATTGCCAACATTTGAATTAAGG + Intronic
986672863 5:10158504-10158526 GGTTGACAACACATAAACTTTGG + Intergenic
986748893 5:10767503-10767525 AGTTTCCAACACATGAATTTTGG - Intergenic
986874344 5:12088973-12088995 AGTTTCCAACACATGAAATTTGG + Intergenic
987041903 5:14070755-14070777 AGTTTCCAACACATCAACTTTGG + Intergenic
987154827 5:15078524-15078546 GATTTCCAACACATGAACTTTGG - Intergenic
987477766 5:18412899-18412921 AGTTTCCAGCACATGAACTTTGG - Intergenic
987648352 5:20706463-20706485 GGTTTCCAACACATAAACTTTGG - Intergenic
987969715 5:24927022-24927044 AGTTTCCAACACATGAATTTTGG - Intergenic
988326443 5:29774588-29774610 AGTTTCCAACACATGAGCTGTGG - Intergenic
988747974 5:34162450-34162472 GGTTTCCAACACATAAACTTTGG + Intergenic
989016413 5:36939923-36939945 AGTTTCCAACAAATGAACTTTGG + Intronic
989340395 5:40367767-40367789 AGTTGCCAACACATAAATTTGGG + Intergenic
989398609 5:40984987-40985009 AGTTTCCAACACATGAACTTTGG + Intergenic
989795002 5:45457930-45457952 GGTTTTCAACACATGAAGTTAGG + Intronic
990146580 5:52767651-52767673 AGTTACCAACACATGAAATTTGG + Intergenic
990319265 5:54613547-54613569 TGTTTCCAACACAAGAACTTTGG + Intergenic
990697269 5:58434166-58434188 GGTTTCCAACACATGACTTCTGG - Intergenic
991491453 5:67187761-67187783 AGTTCTCAACACATGAACTTTGG - Intronic
991604445 5:68386271-68386293 AGTTTCCAACACATGATCTTTGG - Intergenic
992113661 5:73519330-73519352 TGTTTCCAACACATGAAATTTGG + Intergenic
992270575 5:75058840-75058862 AGTTTCCAACACATGAACTTTGG + Intergenic
992393680 5:76352339-76352361 TGTTTCCAACACGTGAACTTTGG - Intronic
992411943 5:76513824-76513846 GTGAGCCATCACATGAACTATGG + Intronic
994619492 5:102146207-102146229 AGTTTCCAACACCTGAACTTTGG + Intergenic
995572499 5:113495071-113495093 AGTTTCCAACACATGAACTTTGG + Intergenic
995788189 5:115854235-115854257 AATTTCCAACACATGAACTTTGG + Intronic
996504195 5:124251099-124251121 AGTTTCCAACACATAAACTCTGG - Intergenic
997231660 5:132249183-132249205 AGTTTCCAACACATGAACTCTGG + Intronic
997277245 5:132605257-132605279 GGTTTCAAACTCCTGAACTAAGG + Intronic
997989342 5:138531053-138531075 AGTTTCCAACACATGAATTTGGG - Intronic
998057682 5:139092854-139092876 AGTTTCCAACACATGAACTTTGG - Intronic
998238796 5:140423780-140423802 AGTTTCTAACACATGAACTTTGG - Intronic
998593745 5:143505767-143505789 AGTTTCCAACACATGAACTTTGG + Intergenic
998700750 5:144696813-144696835 AGTTTTCAACACATGAATTATGG - Intergenic
999038361 5:148379048-148379070 AGTTTGCAACACATGAACTTTGG + Intergenic
1000017196 5:157288368-157288390 AGTTTCTAACACATGAACTTTGG + Intronic
1000256392 5:159542467-159542489 AGTTTCCAACACATGAATTTTGG - Intergenic
1001830869 5:174788370-174788392 AGTTTCCAACACATAAACTTTGG + Intergenic
1002919878 6:1560451-1560473 AGTTTCCAACACAGGAACTTTGG + Intergenic
1003263083 6:4540961-4540983 AGTTTCCAATACATGAACTTTGG - Intergenic
1003401957 6:5797883-5797905 AGTTTCCAACACATGAACTTTGG - Intergenic
1003629684 6:7775145-7775167 AGTCTCCAACACATGAACTTTGG + Intronic
1003839692 6:10107105-10107127 AGTTTCCAACACATGAATTTTGG - Intronic
1003896142 6:10609512-10609534 AGTTTCCAACACATGAATTTTGG + Intronic
1004149419 6:13101382-13101404 AGTTCCCAACACCTGAACTTTGG + Intronic
1004249920 6:14015388-14015410 AGTTTCCAACACATAAACTTTGG + Intergenic
1004414591 6:15413901-15413923 GGTTTCCAACACATGAACTTTGG + Intronic
1004880486 6:20002628-20002650 GGTTTCCAACACATGAATTTTGG - Intergenic
1005229796 6:23686381-23686403 AGTTTCCAACACATAAACTTTGG + Intergenic
1005393876 6:25361657-25361679 AGTTTCCAACACATGAAATTTGG - Intronic
1005545558 6:26865537-26865559 GGTTTCCAACACATAAACTTTGG + Intergenic
1005878481 6:30034542-30034564 AGTTTCCAACACATGAACTTTGG - Intergenic
1006401769 6:33821863-33821885 AGTTTCCAACACATGAACTGTGG - Intergenic
1006791344 6:36703313-36703335 AGTTTCCAACACATGAACTTTGG + Intronic
1006843133 6:37043802-37043824 AGTTTCCAACACATGAACTTTGG + Intergenic
1007187662 6:39986165-39986187 GGTTTCTAAAGCATGAACTAGGG - Intergenic
1007209484 6:40180804-40180826 AGTTTCCAACACATGAACTTTGG + Intergenic
1007280657 6:40709952-40709974 AGTTTTCAACACATGAACTTTGG + Intergenic
1007548449 6:42711075-42711097 CGTTTCCAACACAGGAACTTTGG - Intronic
1007818399 6:44541489-44541511 AGTTTCCAACACATGAATTTTGG + Intergenic
1009016260 6:57906303-57906325 GGTTTCCAACACATAAACTTTGG + Intergenic
1009583511 6:65566964-65566986 AGTTTCCAACACATGAAATCTGG - Intronic
1009649741 6:66459998-66460020 CGTTTCCAACACATGCACTTGGG - Intergenic
1009760258 6:67996206-67996228 AGTTTCCAACATATGAACTTTGG - Intergenic
1010155875 6:72791952-72791974 AGTTTTCAACACATGAACTTTGG + Intronic
1010514802 6:76760258-76760280 AGTTTCCAACACATGAACTTTGG + Intergenic
1010521121 6:76838991-76839013 AGTTTCCAACACATGAATTTTGG - Intergenic
1010752747 6:79632808-79632830 GTTTGCAAACACATGAAGTGTGG - Intronic
1012859421 6:104541571-104541593 AGTTTCCAACACATGCACTTTGG + Intergenic
1012998046 6:105993007-105993029 GGGTCCCAAGACATGACCTAAGG + Intergenic
1013545205 6:111150057-111150079 AGTTTCCAACAAATGAACTTTGG - Intronic
1013567887 6:111386936-111386958 GGTTGCCAACTCCTGACCTCAGG + Intronic
1013869403 6:114739269-114739291 AGTTTCCAACACATGAATTTGGG - Intergenic
1013981006 6:116129364-116129386 AGTTTCCAACACATGAACTTTGG - Intronic
1014619514 6:123648233-123648255 GGATTTCAACACATGAACTTGGG + Intergenic
1014962466 6:127704117-127704139 GGTTTCCAACATATGAATTTTGG + Intergenic
1015137885 6:129894542-129894564 TGCTTCCAACACATGAACTTTGG - Intergenic
1015665746 6:135626550-135626572 AGATTCCAACACATGAACTTTGG - Intergenic
1016906254 6:149153310-149153332 AGTTTCCAACACATGCACTTTGG - Intergenic
1017561181 6:155629573-155629595 CATTTCCAACACATGAACTTTGG + Intergenic
1017768330 6:157625147-157625169 AGTTTCCAACACACGAACTTCGG + Intronic
1018004032 6:159603628-159603650 AGCTTCCAACACATGAACTTTGG + Intergenic
1018045345 6:159960887-159960909 AGTTTCCAACATATGAACTTTGG + Intergenic
1018175126 6:161171931-161171953 AGTTTCCAACACATGAACTCTGG + Intronic
1018988795 6:168657920-168657942 AGTTTCCAGCACATGAACTTTGG + Intronic
1019804638 7:3114301-3114323 AGTTTCCAACACATGGACTTTGG - Intergenic
1020390199 7:7649480-7649502 AGTTTCTAACACATGAACTTTGG + Intronic
1020430138 7:8110164-8110186 AATTTCCAACACATGAACTTTGG - Intergenic
1020738857 7:11987631-11987653 GGTTTCCAACACAAGAAATTTGG - Intergenic
1021774106 7:24035044-24035066 AGTTTTCAACACATGAACTTTGG + Intergenic
1023029721 7:36081459-36081481 AGTTTCCAACACATGAACACTGG - Intronic
1024660469 7:51488148-51488170 AGTTTCCAACATATGAACTTTGG - Intergenic
1024710852 7:52012798-52012820 AGTTTCCAACACATGAACTTTGG - Intergenic
1024818084 7:53294568-53294590 GTTTGCAAACAGGTGAACTAAGG + Intergenic
1025058295 7:55783048-55783070 GGTTTCCAACACGTGAACTTTGG + Intergenic
1025828115 7:65026937-65026959 AGTTTCCAACACATGAACTTTGG - Intergenic
1025915645 7:65863370-65863392 AGTTTCCAACACATTAACTTTGG - Intergenic
1026126094 7:67580933-67580955 AGTTTCCAACACATGAATTTTGG + Intergenic
1026336563 7:69398871-69398893 AGTTTCCAACACATGAATTTTGG - Intergenic
1026507213 7:70995203-70995225 AGTTTCCAATACATGAACTCTGG + Intergenic
1026531189 7:71198846-71198868 GGCAGCCAACACATAAACGAAGG - Intronic
1026739243 7:72968534-72968556 CGTTTCCAACACATGAAATTAGG - Intronic
1026790273 7:73327150-73327172 AGTTTCCAACACATGAAATTAGG - Intronic
1026803216 7:73412869-73412891 GGTTTTCAACACCTGAACTCAGG - Intergenic
1027104488 7:75396539-75396561 CGTTTCCAACACATGAAATTAGG + Intronic
1027154841 7:75759554-75759576 AGTTTCCAACACATGAATTTGGG - Intergenic
1027178504 7:75920739-75920761 GGTTAGGAACACGTGAACTACGG + Intronic
1027454225 7:78367603-78367625 TTTTGCCAACATATGGACTAAGG + Intronic
1028042297 7:86068921-86068943 GGTTAACAACAAATGAATTAAGG - Intergenic
1029941487 7:104484953-104484975 AGTTTCCAACACATGAACTTTGG + Intronic
1030338530 7:108351058-108351080 AGGTTCCAACACATGAACTTTGG - Intronic
1030362828 7:108612698-108612720 CATTTCCAACACATGAACTTTGG + Intergenic
1030601838 7:111601951-111601973 AGTTTCCAACACATGCACTTTGG + Intergenic
1030680345 7:112427306-112427328 AGTTTCCAACACATGAACTTTGG + Intronic
1031035944 7:116787701-116787723 AGTGTCCAACACATGAACTTTGG + Intronic
1031322432 7:120348093-120348115 GGATGTCAACATATGAATTATGG + Intronic
1031332445 7:120482497-120482519 AGTTTCCAACACATGAAATTTGG - Intronic
1031418120 7:121517604-121517626 AGTTTCCAACACATGAAGTTTGG + Intergenic
1031632559 7:124062313-124062335 AGTTTTCAACACATGAACTTTGG - Intergenic
1032010080 7:128340188-128340210 AGTTTCCAACACATGAAATTTGG - Intronic
1032230207 7:130067750-130067772 AGTTTCCAACACATGAACTGTGG + Intergenic
1032823475 7:135546208-135546230 AGTTGCCAACACATGAACTTTGG + Intergenic
1033059949 7:138096535-138096557 AGTTTCCAACACATGAATTAGGG + Intronic
1033195977 7:139327668-139327690 AGTTTCCAACATATGAACTTTGG + Intergenic
1033737969 7:144243544-144243566 AGTTTCCAACTCATGAACTTTGG - Intergenic
1033745086 7:144307413-144307435 AGTTTCCAACTCATGAACTTTGG + Intergenic
1034056097 7:148036306-148036328 AGTTTCTAACACATGAACTTTGG - Intronic
1034192514 7:149223188-149223210 GGTCTCCAACTCCTGAACTAAGG + Intronic
1034947670 7:155273870-155273892 GGTTTCCAACATATGAGCTTTGG + Intergenic
1035554771 8:558490-558512 AGTTTCCAACACAGGAACTTTGG + Intergenic
1035725257 8:1820813-1820835 AGTTTCCAACACATAAACTTTGG - Intergenic
1037215756 8:16449122-16449144 AGTTTCCAACACATGAATTCTGG + Intronic
1037972881 8:23186826-23186848 AGTTTCCAACACATGAACTTTGG - Intergenic
1038003700 8:23412131-23412153 AGTTTCCAACACATGAACTCTGG + Intronic
1038556600 8:28523780-28523802 AGTTTCCAATACATGAACTTTGG - Intronic
1038726270 8:30085030-30085052 AGTTTCCAACACATGAGCTTTGG - Intergenic
1039134689 8:34308347-34308369 AGTTTCCAACACATGAGCTTTGG - Intergenic
1039853787 8:41395429-41395451 AGTTTCCAACACTTGAACTTTGG + Intergenic
1040378140 8:46846285-46846307 GGTAGCCCACACATGAAGTCTGG + Intergenic
1041436782 8:57850518-57850540 GCTTGCCAACATCTGCACTAGGG - Intergenic
1042063154 8:64843494-64843516 AGTTGCCAGCACATGAGCTTTGG - Intergenic
1042076543 8:65001485-65001507 AGTTGCCAACACATGAACTTTGG + Intergenic
1042197023 8:66239526-66239548 AGTTTCCAACACATGAACTTGGG + Intergenic
1042248027 8:66727495-66727517 AGTTTCCAACACATGCACTGTGG - Intronic
1042481818 8:69312970-69312992 AGTTTCCAACACATGAACTGGGG + Intergenic
1042935450 8:74053730-74053752 AGTTTCCAACACATGAAATTTGG - Intergenic
1043056896 8:75450713-75450735 AGTGTCCAACACATGAACTTTGG - Intronic
1043469447 8:80547801-80547823 AGTTTCCAACACATGAACTTTGG + Intergenic
1043480566 8:80648198-80648220 TATTTCCAACACATGAACTTTGG + Intronic
1043624958 8:82244750-82244772 AGTTTCCAACACATGAACTTTGG - Intergenic
1044554833 8:93551846-93551868 AGTTTCCAACACATAAACTTTGG + Intergenic
1044925711 8:97207053-97207075 AGTTTCCAACACATGAACTTTGG + Intergenic
1045008899 8:97940508-97940530 GGTGGGCAATAAATGAACTAGGG - Intronic
1045046721 8:98285944-98285966 AGTTTCCAACACATGAACTTTGG - Intronic
1045683255 8:104685098-104685120 AGTTTCCAATACATGAACTTTGG + Intronic
1045830919 8:106459137-106459159 AGTTTCCAACACATGAACTTTGG - Intronic
1045864285 8:106847003-106847025 GCTTGCCAACTCATAGACTAAGG + Intergenic
1046581442 8:116097974-116097996 AGCTTCCAACACATGAACTTTGG - Intergenic
1046650425 8:116831503-116831525 TGTTTCCAACACATGAATTTTGG - Intronic
1047006399 8:120624552-120624574 AGTTTCTAACACATGAACTTTGG + Intronic
1047006476 8:120625206-120625228 AGTTTCCAACACATGAACACTGG + Intronic
1047425588 8:124742595-124742617 AGTTTCCAAAACATGAACTTTGG + Intergenic
1047491980 8:125382643-125382665 AGTTTCCAACACATGAAATTTGG + Intergenic
1047568310 8:126070756-126070778 AGTTTCCAACACATGAACTTTGG + Intergenic
1047799355 8:128292827-128292849 AGTTTCCAACACATGAAATTTGG + Intergenic
1047844741 8:128793799-128793821 TGTTTCCAACACATGAAACATGG - Intergenic
1047913944 8:129561488-129561510 AGTTTCCAACACATGAACTTTGG - Intergenic
1048601897 8:135927460-135927482 AGTTTCCAACACATAAACTTTGG - Intergenic
1048699822 8:137076273-137076295 GGTTTCCAACACATGAATTTTGG - Intergenic
1048885736 8:138907954-138907976 AGTTCCCAACACATGAACTTTGG + Intronic
1050415497 9:5412371-5412393 AGTTTCCCACACATGAACTTTGG - Intronic
1050576487 9:7001585-7001607 GGTGGCCATCACACCAACTAAGG - Intronic
1050770269 9:9190078-9190100 AGTTTCCAACACATGAACTTTGG - Intronic
1050802791 9:9637121-9637143 AGTTTCCAACACATGAATTGTGG + Intronic
1051306577 9:15716870-15716892 AGTTTCCAACACGTGAACTTTGG + Intronic
1051501991 9:17788161-17788183 GATTGCCATAACTTGAACTAGGG + Intronic
1052182526 9:25547169-25547191 AGTTTCCAACACATGAAATTTGG - Intergenic
1052300068 9:26944002-26944024 AGTTTCCAGCACATGAACTTTGG - Intronic
1052464761 9:28816226-28816248 AGTTACCAACACATGAACTTTGG + Intergenic
1052680835 9:31690379-31690401 AATTTCCAACACATGAACTTCGG - Intergenic
1052830058 9:33207797-33207819 AGTTTCCAACACATAAACTTGGG + Intergenic
1053027706 9:34744104-34744126 GGTTTCCAACACATGAACTTTGG + Intergenic
1053034363 9:34811291-34811313 AGTTTCCAACACATGAACTTTGG - Intergenic
1053450642 9:38191574-38191596 AGCTTCCAACACATGAACTTTGG + Intergenic
1055388682 9:75794712-75794734 AGTTTCCAACCCATGAACTTTGG + Intergenic
1055450103 9:76423224-76423246 AGTTTCCAACACATGAACTTTGG - Intronic
1056033583 9:82580440-82580462 TGTTTCCAACACATGAATTTTGG + Intergenic
1057364232 9:94403883-94403905 AGTTCCCAACACATGAATTTTGG - Intronic
1057659104 9:96984188-96984210 AGTTCCCAACACATGAATTTTGG + Intronic
1057762747 9:97889843-97889865 GGATTTCAACACATGAACTAGGG + Intergenic
1058546110 9:106061718-106061740 AGTTTACAACACATGAACTTTGG - Intergenic
1058837265 9:108869303-108869325 GGTAGCAGACACATGAACTCTGG - Intronic
1058931732 9:109726860-109726882 GGTTTTCAACACTTGAAATATGG - Intronic
1058980711 9:110167430-110167452 GGTTGCCAACATATGAAAAATGG - Intronic
1059069267 9:111118239-111118261 AGTTTCCAACACACGAACCATGG + Intergenic
1059304546 9:113343660-113343682 AGTTTCCAGCACATGAACTTTGG + Intergenic
1059477138 9:114556502-114556524 AGTTTCCAACACATGAAATTTGG - Intergenic
1059510290 9:114839098-114839120 AGTTTCCCACACATGAACTTTGG + Intergenic
1059820710 9:117969244-117969266 AGTTTCCAACACATAAACTTTGG + Intergenic
1060119556 9:120975469-120975491 GCTTTCCAACACATGAACTTTGG - Intronic
1061785682 9:133026692-133026714 AGTTTCCAACACATGAAATTTGG + Intergenic
1062174477 9:135153344-135153366 GGTTGCCAGCGCAGGAACCAAGG - Intergenic
1185431907 X:16311-16333 AATTGCCAACACATGAAATCTGG + Intergenic
1185441225 X:229023-229045 AATTGCCAACACATGAAATCTGG + Intergenic
1186170144 X:6868051-6868073 AGTTTCCAACACATGACCTTTGG + Intergenic
1186179635 X:6960224-6960246 GATTTCCAACACCTGAACTTTGG - Intergenic
1186664473 X:11703904-11703926 GGTCCCCAACACCTGAACTCAGG + Intergenic
1186734291 X:12444885-12444907 AGTTTCCAACACATGAACTTTGG + Intronic
1186877193 X:13828178-13828200 AGTTTCCAACACATGAAATTTGG - Intronic
1186926848 X:14343060-14343082 TGTTGCCAACACATAAACTTTGG + Intergenic
1187292003 X:17963556-17963578 AGCTTCCAACACATGAACTTTGG + Intergenic
1187305445 X:18091310-18091332 AGTTTCCAACAAATGAACTTTGG - Intergenic
1187549977 X:20292841-20292863 AGTTTCCAACACAGGAACTTTGG - Intergenic
1187679558 X:21753337-21753359 GGTTGCAAACACATCATCAAGGG - Intronic
1188033082 X:25285816-25285838 AGTTTCCAACACATGAACTATGG + Intergenic
1188520049 X:31028978-31029000 AGTTTCCAACACATGAACTTCGG - Intergenic
1188527885 X:31106006-31106028 AGTTGCCAACACATGAAATTTGG - Intronic
1188611315 X:32101787-32101809 AGTTTCCAACACATGAAATTTGG - Intronic
1188727254 X:33601282-33601304 AGTTTCAAACACATGAACTTTGG + Intergenic
1188961737 X:36501301-36501323 AGTTTCCAAAACATGAACTTTGG - Intergenic
1189712385 X:43826883-43826905 AGTTGCCAACACATAAATTTTGG + Intronic
1189973076 X:46437627-46437649 AGTTTCCAACACATGAACTTTGG + Intergenic
1190404577 X:50073908-50073930 GTTTGCCAACCCATGGCCTAGGG + Intronic
1190710150 X:53062178-53062200 GGTTTCCAACACATGAACTTCGG + Intronic
1192272834 X:69599563-69599585 AGTTTTCAACACATGAACTTTGG + Intergenic
1192337004 X:70229993-70230015 AGTTTCTAACACATGAACTTTGG + Intergenic
1192819850 X:74633486-74633508 AGTTTCCAACACATGAACTTTGG - Intergenic
1194151614 X:90331694-90331716 AGTTTCCAACACATGAACTTTGG + Intergenic
1194406574 X:93503497-93503519 AATTTCCAACACATGAACTTTGG + Intergenic
1194762310 X:97809394-97809416 AGTTTCCAACACATGAACTTTGG + Intergenic
1194957568 X:100198608-100198630 GGATGTCAACACATGAATTTTGG - Intergenic
1195196724 X:102504096-102504118 GGTTTCCAACACATGGATTTGGG + Intergenic
1195228830 X:102825289-102825311 GGTTTCCAACAAATGAACTTTGG + Intergenic
1195315107 X:103669834-103669856 AGTTTCCAACACATGAGCTTTGG - Intergenic
1196095566 X:111794865-111794887 GGTTTTCAACATATGAACTTGGG + Intronic
1196366560 X:114930939-114930961 TGTTTCCAACACATGAATTTTGG + Intergenic
1196553884 X:117063820-117063842 TGTTTCTAACACATGAACTTTGG - Intergenic
1196729937 X:118930588-118930610 AGTTTCCAACACATGAATTTTGG - Intergenic
1196932696 X:120696814-120696836 GAGTGCCAAGTCATGAACTATGG + Intergenic
1197316650 X:124974298-124974320 AGTTTCCAACACATAAACTTTGG + Intergenic
1197349117 X:125360412-125360434 AGTTTCCAAAACATGAACTTTGG - Intergenic
1198319001 X:135499766-135499788 ACTTTTCAACACATGAACTATGG - Intergenic
1198455716 X:136815734-136815756 AGTTTCCAACACATGAAATTTGG + Intergenic
1198481505 X:137045640-137045662 GGATTTCAACACATGAACTTCGG + Intergenic
1198614033 X:138434466-138434488 GGTTGCCAGGACAATAACTAGGG - Intergenic
1199477848 X:148265466-148265488 AGTTTCCAACACATGAATTCTGG + Intergenic
1199573140 X:149288370-149288392 TGTTGTCAACTCAGGAACTAGGG + Intergenic
1199992616 X:152996240-152996262 AGTTTCCAACACATGAACTCTGG + Intergenic
1200274780 X:154721600-154721622 AGTTTCCAACACATGAACTTTGG + Intronic
1200497973 Y:3908441-3908463 AGTTTCCAACACATGAACTTTGG + Intergenic
1200842303 Y:7795234-7795256 AGTTTCCAACACATGAATTTTGG - Intergenic
1201187899 Y:11421643-11421665 AATTTCCAACACATGAACTTCGG + Intergenic