ID: 1183730895

View in Genome Browser
Species Human (GRCh38)
Location 22:39617811-39617833
Sequence CAAGGGAAGGAGCAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2163
Summary {0: 1, 1: 0, 2: 16, 3: 251, 4: 1895}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183730895 Original CRISPR CAAGGGAAGGAGCAGGAGGA GGG (reversed) Intronic
Too many off-targets to display for this crispr