ID: 1183732424

View in Genome Browser
Species Human (GRCh38)
Location 22:39626111-39626133
Sequence GCACAGAGCAAACCTCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183732424_1183732431 17 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732431 22:39626151-39626173 GTCCCAGGGCCTCCACCCACTGG 0: 1
1: 0
2: 0
3: 30
4: 323
1183732424_1183732435 24 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732435 22:39626158-39626180 GGCCTCCACCCACTGGCTGTGGG 0: 1
1: 0
2: 4
3: 24
4: 258
1183732424_1183732427 -5 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732427 22:39626129-39626151 TGTGCTGTCAGGCCAGGTTCTGG 0: 1
1: 0
2: 2
3: 11
4: 154
1183732424_1183732434 23 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732434 22:39626157-39626179 GGGCCTCCACCCACTGGCTGTGG No data
1183732424_1183732429 3 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732429 22:39626137-39626159 CAGGCCAGGTTCTGGTCCCAGGG 0: 1
1: 0
2: 4
3: 16
4: 267
1183732424_1183732428 2 Left 1183732424 22:39626111-39626133 CCAGCTGGAGGTTTGCTCTGTGC 0: 1
1: 0
2: 0
3: 12
4: 191
Right 1183732428 22:39626136-39626158 TCAGGCCAGGTTCTGGTCCCAGG 0: 1
1: 0
2: 4
3: 21
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183732424 Original CRISPR GCACAGAGCAAACCTCCAGC TGG (reversed) Intronic
902155207 1:14479480-14479502 GCAGAGAGCAAACCACTAGCAGG - Intergenic
905188818 1:36216984-36217006 TCACAGAGCTTACCTCCAACTGG - Intergenic
905723466 1:40227981-40228003 GGACAGAGCAAGGCTCCATCTGG + Intronic
908029181 1:59981809-59981831 GAACAGGGCAAACCTGCTGCTGG + Intergenic
909282870 1:73778570-73778592 GAACAGAGCAAGCCAGCAGCTGG + Intergenic
912220080 1:107664276-107664298 GCACAGATCAAACCATCACCTGG + Intronic
915526045 1:156476933-156476955 GGAAAGAGCAGACCTCTAGCAGG - Intronic
915645762 1:157270887-157270909 GCACTGAGCCAACCCCCTGCAGG + Intergenic
919249131 1:195030381-195030403 GCAGAGAGGAAACCTGCAGTGGG + Intergenic
919928793 1:202208067-202208089 GGACAGAGAAAAACTGCAGCAGG - Intronic
922665387 1:227464676-227464698 GCAGAGAGCAAACATGCAGATGG + Intergenic
922665532 1:227465597-227465619 GCAGAGAGCAAACATGCAGATGG + Intergenic
922795252 1:228336529-228336551 GCACAGAGCTCACATCCAGCAGG + Intronic
924684801 1:246278097-246278119 GCACAGACCAAACCAACAACTGG + Intronic
1065749196 10:28870207-28870229 CCACAGAGCAAACCTCTCCCCGG - Intronic
1067531180 10:47074735-47074757 GCTCAGGGAAAACCTCCACCTGG - Intergenic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1067854491 10:49780450-49780472 GAACATAGCTCACCTCCAGCTGG + Intergenic
1068060555 10:52063664-52063686 GCTCAGAGAAAACCTGCAGTGGG + Intronic
1068705667 10:60072773-60072795 TCACAGAGCAAAGCACCAGATGG - Exonic
1068735758 10:60411556-60411578 GCAGAGAGCCTAACTCCAGCTGG + Intronic
1070288608 10:75100576-75100598 GCACAGGCCCAACGTCCAGCAGG + Intronic
1072223397 10:93346787-93346809 TCACAAAGCAAAAGTCCAGCAGG - Intronic
1073338186 10:102726401-102726423 GCACAGAGCTGGCCACCAGCAGG + Intronic
1073479643 10:103778386-103778408 GCACAGAGGAAACCCCCAGAAGG + Intronic
1074169528 10:110919295-110919317 CTACAGAGTAAGCCTCCAGCAGG - Intergenic
1075007884 10:118843499-118843521 GCTCAGAGGAAACCTACAGGGGG - Intergenic
1077130385 11:969143-969165 CCTCAGAGCCAGCCTCCAGCAGG - Intronic
1077241210 11:1511285-1511307 GAACAGGCAAAACCTCCAGCAGG + Intergenic
1080419373 11:32096331-32096353 GCCCAGAGCAAACTTCAGGCTGG - Intronic
1081797870 11:45834219-45834241 TCACTAAGCAAAACTCCAGCTGG - Intergenic
1083772600 11:64876912-64876934 GCACAGAGCTGACCTTCAGCAGG - Intronic
1084403792 11:68959791-68959813 GCACAGAGCATGCGTACAGCAGG - Intergenic
1084564714 11:69922321-69922343 GCCCAGGGCACAGCTCCAGCAGG + Intergenic
1087919099 11:103845942-103845964 ACACAGAGCAAACACCAAGCAGG - Intergenic
1088892671 11:114057745-114057767 GCAAAGCGGAAACCTCCAGCAGG + Intergenic
1089295243 11:117463511-117463533 GCACAAAGCAGACCTCCTGGAGG - Intronic
1089861182 11:121591208-121591230 GCCCAGAGCACACCCCCAGAAGG - Intronic
1091647431 12:2284485-2284507 GCACAGAACAGCCCTCCAGGCGG + Intronic
1092135407 12:6143543-6143565 AGACAGAGCAAGACTCCAGCTGG - Intergenic
1092391239 12:8081879-8081901 GAAAAGAGGCAACCTCCAGCCGG - Intergenic
1097129905 12:56804360-56804382 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
1097905839 12:64918963-64918985 GCACAGAGGAGAGCACCAGCTGG + Intergenic
1098486274 12:71025564-71025586 GCACAGAGCAAAAATACAGATGG + Intergenic
1102556416 12:113729629-113729651 GCTCAGAGCTCACCTGCAGCTGG + Intergenic
1104931426 12:132341326-132341348 GCCCAGCGGAAGCCTCCAGCAGG - Intergenic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1106619254 13:31357692-31357714 GAACAGAGCAAACATCAGGCTGG - Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1120698353 14:87669762-87669784 TCACAGAGCACAGCTCCAGGTGG + Intergenic
1122452798 14:101824711-101824733 GCACAGAGCCAACCACCAAGTGG - Intronic
1124192781 15:27594996-27595018 GTACAGAGCAAAACACCATCTGG + Intergenic
1125213901 15:37247027-37247049 GCCCAGGGCAAACCCCCCGCTGG + Intergenic
1125422490 15:39518573-39518595 CCACATACCAAGCCTCCAGCTGG - Intergenic
1125725465 15:41866189-41866211 GCACAGAGTCACCCTCGAGCCGG - Exonic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1127719693 15:61687621-61687643 GCACAGAGCAATAGCCCAGCAGG + Intergenic
1136275603 16:29177699-29177721 GCTCAGAGGACACATCCAGCCGG - Intergenic
1139489813 16:67280100-67280122 GCACACAGCAAATCTCCAGTCGG - Exonic
1140104781 16:71949840-71949862 GCAAAGACCAAGCCACCAGCTGG - Exonic
1140766034 16:78158081-78158103 GCACAGAGGAAAACTCAAGTTGG - Intronic
1140939361 16:79707147-79707169 CCACAGAGAAAAGCCCCAGCAGG - Intergenic
1143928424 17:10394359-10394381 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143936965 17:10496060-10496082 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143939421 17:10524576-10524598 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1143950980 17:10631923-10631945 GCGCAGAGCCAACCTGCTGCAGG - Exonic
1144029179 17:11304413-11304435 TCACAGAGCAAGGCTCAAGCAGG - Intronic
1148546195 17:48520807-48520829 GGACAGAGAAGACCTCCTGCAGG - Intergenic
1149613349 17:57975283-57975305 GGGAAGAGCCAACCTCCAGCAGG + Intronic
1151710111 17:75799612-75799634 GCACAGAGCTGACCCACAGCAGG - Intronic
1152354916 17:79802137-79802159 GCGCAGAGCAGTGCTCCAGCAGG + Intergenic
1158198015 18:54910087-54910109 GCTCAGAGGAAACCTGCAGGGGG + Intronic
1158495944 18:57955256-57955278 TCAGAGAGCAAACCTTCAGAGGG - Intergenic
1160062739 18:75547748-75547770 GCACAGAGAAGAGGTCCAGCTGG - Intergenic
1164574029 19:29395036-29395058 GCACACAGCAAGCCCTCAGCAGG + Intergenic
1164679458 19:30124073-30124095 GCACCGAGCTCCCCTCCAGCGGG + Intergenic
1164684222 19:30156551-30156573 GCACCCAGCACACCTCCACCTGG + Intergenic
1165668181 19:37652268-37652290 TCAGAGAGAAAACCACCAGCCGG + Intronic
1166338114 19:42121452-42121474 TCACAGAGCAAAGCTGTAGCAGG + Intronic
1166603323 19:44117627-44117649 GCACAAAGTAAACCTACAGGAGG + Intronic
925314741 2:2912795-2912817 GCACTGTGCAAACCTCCATATGG - Intergenic
926082397 2:9998112-9998134 CCACAGAGCAAAGCTCAAGGTGG - Intronic
926102913 2:10131993-10132015 CAGCAGAGCAAAACTCCAGCTGG - Intergenic
926632344 2:15147972-15147994 GCACAGAGCAAGGCACCAGGAGG - Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
929266584 2:39925545-39925567 TCACAGAGCAGACCTCAACCTGG + Intergenic
930612073 2:53554603-53554625 GCTCAGAGGAAACCTGCAGTAGG - Intronic
931067355 2:58601369-58601391 GCACAGTGCAGGCATCCAGCAGG + Intergenic
931709128 2:64972625-64972647 GTACAGAGCAAACGTCCTGCGGG - Intergenic
932697556 2:73969374-73969396 GCTCAGAGCCCACCTGCAGCTGG - Intergenic
932825309 2:74933634-74933656 CCACAGAGCAGACCCTCAGCTGG - Intergenic
934480185 2:94631779-94631801 GCACAAAGCAAATATCCAGGAGG + Intergenic
934913813 2:98281808-98281830 GCACACAGCATCCCTCCTGCTGG + Intronic
935061848 2:99615480-99615502 GCCCAGAGAGAACCTCAAGCAGG + Intronic
936725711 2:115312693-115312715 CCATAAAGAAAACCTCCAGCTGG + Intronic
937279051 2:120704943-120704965 GCACAGAGCAGACCTACAAGGGG - Intergenic
947634649 2:231673800-231673822 CAACAGAGCAAAACTCCATCTGG - Intergenic
948768797 2:240236830-240236852 GCACTGCTCAAACCTGCAGCAGG + Intergenic
1170004232 20:11647480-11647502 GCTCAGAGGAAACCTTTAGCAGG - Intergenic
1170755805 20:19206078-19206100 GCACACAGAAATCCCCCAGCAGG + Intergenic
1173424583 20:42931795-42931817 GCACAGAGACAACTTACAGCTGG + Intronic
1173504283 20:43574789-43574811 CCACAGAGCACACGTACAGCAGG + Intronic
1175671314 20:60905248-60905270 GCACAGAGCATGAGTCCAGCTGG + Intergenic
1175933552 20:62504826-62504848 CCACAGAGCCATCATCCAGCAGG - Intergenic
1178455612 21:32747492-32747514 GCACACAGCAAAACTTCAGAAGG + Intronic
1179188808 21:39106456-39106478 CCCAAGAGCAAACCTGCAGCTGG - Intergenic
1179823595 21:43951591-43951613 GCACAGAGCAGGACGCCAGCTGG + Intronic
1179925260 21:44530705-44530727 GCACCGAGCAGACACCCAGCTGG + Intronic
1180517322 22:16157885-16157907 ACTAAGAGCAAACTTCCAGCAGG - Intergenic
1180985903 22:19903780-19903802 CCACAGAGCAAGCCCCCGGCAGG - Intronic
1182759319 22:32709126-32709148 GCACAGAACAAAGCCACAGCTGG - Intronic
1182858028 22:33535241-33535263 TCCAAGAGAAAACCTCCAGCAGG + Intronic
1183023522 22:35046427-35046449 GCACAGAGAAAACCTACAAACGG - Intergenic
1183172203 22:36196912-36196934 GCACAGAGGATTCCTCCTGCTGG + Intronic
1183437069 22:37802500-37802522 GCGCAGAGCCATCTTCCAGCTGG - Intergenic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184407966 22:44310981-44311003 GCAAAGAGCAAACTTCCAGATGG + Intronic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
950027745 3:9832458-9832480 GCACAGAAGATACCTCCAACTGG + Intronic
950117904 3:10463284-10463306 GCACAGAACAGGCCTCCACCAGG + Intronic
952175544 3:30858793-30858815 GCTCAGAGAGAACCTACAGCAGG + Intronic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
958448968 3:94249689-94249711 ACACAGAGCAGACCACCAGGGGG + Intergenic
962115914 3:132507344-132507366 GCAGAGAGCTTACCTCCAGTTGG - Exonic
962257579 3:133883047-133883069 GAACAGAGCAAACCTCCAAAGGG - Intronic
963913088 3:150831514-150831536 GCACAGAGAGAACCTCCTTCTGG + Intergenic
964752796 3:160067855-160067877 GGACAGAGCAAGACTCCATCTGG + Intergenic
965073941 3:163953249-163953271 GCAAAGAGGAAACCCCCAGTGGG + Intergenic
965309851 3:167115281-167115303 GCTCAGAGGAAACCTGCAGGGGG + Intergenic
967816948 3:193807605-193807627 ACACAGAGCAGACATCCAGGAGG + Intergenic
970421996 4:15913774-15913796 GTACAGAGTCAAGCTCCAGCTGG - Intergenic
975307802 4:72868606-72868628 TCACAGAGGAGAGCTCCAGCTGG + Intergenic
976188966 4:82470900-82470922 GCAAAAAGCAAATCACCAGCTGG + Intergenic
976849749 4:89531321-89531343 GGGCATAGCAAACCTTCAGCTGG + Intergenic
977141917 4:93384064-93384086 GCAGAGAGCAAGCCTTCACCAGG - Intronic
977359143 4:95981462-95981484 GCTCAGAGGAAACCCACAGCAGG - Intergenic
980145236 4:128974624-128974646 GCACAGAGCATACTTACAGAAGG - Intronic
980729771 4:136811271-136811293 GCTCAGAGGAAACCTGCAGAGGG + Intergenic
981898678 4:149835576-149835598 CCACTTAGCAAACCTCCTGCAGG + Intergenic
984647552 4:182235535-182235557 GCAGAGAGCAAACAGCAAGCTGG + Intronic
985117067 4:186602907-186602929 GCACTGACCAAACCTGCCGCTGG + Exonic
985775228 5:1837783-1837805 GCAGGGAGCAAACCACCCGCTGG - Intergenic
986148951 5:5109577-5109599 GCACAGGGCAGCCCTCCAGCAGG - Intergenic
987235319 5:15936404-15936426 GCTCAGAGCAACCTGCCAGCAGG - Intronic
989681695 5:44037139-44037161 GCACAGATCAAACCATCACCTGG + Intergenic
990647008 5:57856580-57856602 CCACAGAGCAAGACTCCATCTGG - Intergenic
992866069 5:80958578-80958600 GAACAATGCAAACTTCCAGCTGG + Intergenic
996104501 5:119483324-119483346 TCACAGGGCAAACCACCATCAGG - Intronic
999277555 5:150341468-150341490 GCAGCCAGCCAACCTCCAGCAGG - Intergenic
1001046003 5:168372247-168372269 CCAGGGAGCAATCCTCCAGCGGG + Intronic
1001163419 5:169341661-169341683 GCACATAGGAAACATGCAGCAGG - Intergenic
1002873071 6:1185108-1185130 GCATGGAGGAAAGCTCCAGCAGG - Intergenic
1004193463 6:13484796-13484818 CCACAGAGCAAACCTAGAGCAGG - Intronic
1006677598 6:35775657-35775679 GCACAGAGCAATCCTGGAACCGG - Intergenic
1007756816 6:44104812-44104834 GCCAGGAGCCAACCTCCAGCAGG + Intergenic
1013233785 6:108178750-108178772 GCACAGTGCACACCTCCTGTAGG + Intronic
1014209953 6:118698061-118698083 GCCCAGAGGAATGCTCCAGCTGG - Intronic
1016404404 6:143715340-143715362 GCACATAGCAACCTTCCTGCTGG - Intronic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1019152449 6:170017915-170017937 GCACAAAGCAAACGTGCAGTCGG + Intergenic
1019415068 7:923308-923330 GCAGAGAGGAGCCCTCCAGCCGG + Intronic
1020816163 7:12908689-12908711 GCACAGAACTAATCTCAAGCCGG + Intergenic
1022442646 7:30446619-30446641 GCGCAGGGCACACCTACAGCAGG + Intronic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1023856262 7:44185990-44186012 GCAGAGTGCAAAGCTCCAGGTGG - Intronic
1024054900 7:45653689-45653711 ACACAGAGCAAAGCCCCAGTGGG - Intronic
1026922957 7:74169932-74169954 GCACATAGCCCACCTCCACCTGG - Intergenic
1027264499 7:76486763-76486785 GCACAGAGCAAAACGCCCACAGG - Intronic
1027315869 7:76984877-76984899 GCACAGAGCAAAACGCCCACAGG - Intergenic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1031202697 7:118710076-118710098 GAACAGAACAAACATCCAGAAGG + Intergenic
1034422897 7:150998626-150998648 GCACAGAGCCATCCTGCTGCCGG - Exonic
1035045607 7:155963526-155963548 GCACAGAGCAAGACCACAGCTGG - Intronic
1038828338 8:31032339-31032361 GCAAAGAGCAAGGCTCCAGAAGG - Exonic
1040517895 8:48149220-48149242 GCACAGAGCAACCCTGGAGAAGG - Intergenic
1040520019 8:48168769-48168791 TCATAGAGCATAGCTCCAGCTGG - Intergenic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1046757342 8:117985342-117985364 TCAGAGAGAAAACCTCTAGCGGG + Intronic
1048517077 8:135120865-135120887 GCACAGAGGAAGCCTCCATATGG - Intergenic
1048795537 8:138146027-138146049 GAACAGTGCAGACCTCCGGCTGG - Exonic
1049826262 8:144670699-144670721 GCTCAGGGCAAGCCTCCAGGAGG - Intergenic
1053677661 9:40452140-40452162 GCACAAAGCAAATATCCAGGAGG - Intergenic
1053927579 9:43079976-43079998 GCACAAAGCAAATATCCAGGAGG - Intergenic
1054286063 9:63172815-63172837 GCACAAAGCAAATATCCAGGAGG + Intergenic
1054290734 9:63287666-63287688 GCACAAAGCAAATATCCAGGAGG - Intergenic
1054388755 9:64592213-64592235 GCACAAAGCAAATATCCAGGAGG - Intergenic
1054506961 9:65924158-65924180 GCACAAAGCAAATATCCAGGAGG + Intergenic
1054923102 9:70561450-70561472 CCACAGAGAAAACCTCCACCTGG - Intronic
1056462261 9:86819139-86819161 GCTCTGTGCAAACCTGCAGCTGG - Intergenic
1061404899 9:130388221-130388243 ATACAAAGCAAAGCTCCAGCGGG - Intronic
1061592006 9:131603757-131603779 GCAAAGGGCAGACCTCCACCTGG + Intronic
1061994817 9:134177986-134178008 TCACAGTGCAGACCTCCATCCGG - Intergenic
1194212238 X:91082839-91082861 GCAGAGAGGAAACCTGCAGTGGG - Intergenic
1194556374 X:95365496-95365518 GCACAGAGCATTCCTGCAGGGGG + Intergenic
1196312462 X:114184220-114184242 TCACAGAGAAGAGCTCCAGCTGG + Intergenic
1197342241 X:125287839-125287861 GCAGAGAGGAAACCCACAGCAGG - Intergenic
1198552494 X:137759363-137759385 ACACAAAGGCAACCTCCAGCTGG - Intergenic
1199798117 X:151222336-151222358 ATACAGAGCAAGCCTCCAGGAGG - Intergenic
1201371403 Y:13268928-13268950 TCATAGAGCAGAGCTCCAGCTGG - Intronic
1202349693 Y:23974691-23974713 GCTCAGAGCAGACATTCAGCAGG - Intergenic
1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG + Intergenic