ID: 1183733736

View in Genome Browser
Species Human (GRCh38)
Location 22:39632126-39632148
Sequence AGCGACAAAGGCCGGCCCGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1183733732_1183733736 6 Left 1183733732 22:39632097-39632119 CCAGAGAACAAGGGAGATGTAAT No data
Right 1183733736 22:39632126-39632148 AGCGACAAAGGCCGGCCCGAGGG No data
1183733731_1183733736 7 Left 1183733731 22:39632096-39632118 CCCAGAGAACAAGGGAGATGTAA No data
Right 1183733736 22:39632126-39632148 AGCGACAAAGGCCGGCCCGAGGG No data
1183733728_1183733736 26 Left 1183733728 22:39632077-39632099 CCTTTTGGAATTTCAATATCCCA No data
Right 1183733736 22:39632126-39632148 AGCGACAAAGGCCGGCCCGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1183733736 Original CRISPR AGCGACAAAGGCCGGCCCGA GGG Intronic